[Bioperl-l] Build.PL? Can't I just use bioperl-live from github? (rosalind.info looks cool)

[Jay Hannah]

On Jun 26, 2014, at 12:04 AM, Fields, Christopher J <cjfields at illinois.edu> wrote:
> Other module sets we have moved out are into separate distributions are Bio::Assembly, Bio::EUtiities, Bio::FeatureIO, but they’re not as break-y as a missing Bio::Root :)  You could simply grab the latest github repo and add it to your PERL5LIB.  At the moment I don’t think it has a pass-through Build.PL/Makefile.PL (we’re using Dist::Zilla).

Ah, there we go, thanks. I'm back in business.   :)

$ export PERL5LIB=~/src/bio/bioperl-live/:~/src/bio/bio-root/lib
$ perl dna.pl
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC
GCTGCTATCAGACACTCTTTTTTTAATCCACACAGAGACATATTGCCCGTTGCAGTCAGAATGAAAAGCT

Yay! I had forgotten that bit, if I had known it at some point.

---

I know little about Dist::Zilla, but I've been poking around in 

https://github.com/bioperl/dist-zilla-pluginbundle-bioperl

Shouldn't Build.PL be gone from bioperl-live, and a dist.ini added?

On Jun 26, 2014, at 7:33 AM, Chris Maloney <voldrani at gmail.com> wrote:
> Could you switch master into a feature branch, and put master back to some last-known-good commit?

I agree master should be usable via Build.PL or dist.ini. Currently it's halfway transitioned between the two (broken)?

Should I try to hack out a dist.ini for bioperl-live? Should that be master? Or is there a known historical point which should be master for now?

Thanks again for your time,   :)

j