[Bioperl-l] use Bio::SeqIO to read Fasta sequence from pipe, or @ARGV, like "while (<>) {....}"

[Paul Cantalupo]

Hi Haiyan,

Ah your specifications are now clearer! I use the '-p' file test to check
if STDIN is a named pipe (http://perldoc.perl.org/functions/-X.html) to do
the same thing that you are trying to do:

use strict;
use warnings;
use Bio::SeqIO;
my $in;
if (-p STDIN) {
  $in = Bio::SeqIO->new(-fh => \*STDIN, -format => 'fasta');
}
else {
  $in = Bio::SeqIO->new(-file => shift);
}
while (my $seq = $in->next_seq) {
  print $seq->length,"\n";
}


Here is my input file and results when running both ways:

$ cat foo.fa
>foo1
tgtagtc
>foo2
taaaacgtgtcat

$ cat foo.fa | both.pl
7
13

$ both.pl foo.fa
7
13

Hope this helps,

Paul


P.S. Next time you ask a question, your reply to Chris Fields is exactly
how you should ask a question. It will enable us to better help you   ;)






Paul Cantalupo
University of Pittsburgh


On Mon, Jul 14, 2014 at 1:26 AM, Haiyan Lin <linhy0120 at gmail.com> wrote:

> Thanks all reply and advice first.
>
> I want to handle a single can handle data provided in two ways:
>
> 1）Read data from a file, such as "perl fastaLen.pl try.fa". No problem
> for "-fh=>$filename".
>
> 2)Read data from output of cmmand, such as "less try.fa | perl
> fastaLen.pl". No probelm when using "-fh=>\*STDIN".
>
>
> And, I can do this by first read data through <>, and write into a tmp
> file, and
> creat instance of Bio::SeqIO with "-fh=>\$tmpFile", then remove the tmp
> file.  I'm looking for a way to avoiding writing/removing tmp file.
>
> Thanks.
>
> Haiyan
>
>
>
>
>
>
> On Sun, 2014-07-13 at 15:12 +0000, Fields, Christopher J wrote:
> > Haiyan,
> >
> > Do you want a test script that uses the DATA handle or a script that can
> pull in data from STDIN (e.g. from outside)?  They are not the same.  It’s
> possible to do both but I think you’re conflating purposes here; someone
> using this script might not expect it to behave both ways.
> >
> > chris
> >
> > On Jul 12, 2014, at 9:23 PM, Haiyan Lin <linhy0120 at gmail.com> wrote:
> >
> > > Hi, geogre,
> > >
> > > Thanks your code is working for data embedded in code with "__DATA__".
> > > But, it failed to hand data from outside. Following is the data and
> > > result.
> > >
> > > [linhy at bioinfo1 Script]$ more try.fa
> > >> Contig000001
> > > CCACGTAAGAGCACCTGGGTCCCCGCCCGCCAAGCGCCGCGAGCGCCAGCAGCAGCTCGC
> > >> hello
> > > ATATATTTTT
> > > [linhy at bioinfo1 Script]$ cat try.fa | perl try.pl
> > > seq is AGAGAGAGA
> > > seq is ATATATAT
> > >
> > > Thanks
> > >
> > > Haiyan
> > >
> > >
> > >
> > > On Sat, 2014-07-12 at 18:36 -0700, george hartzell wrote:
> > >> I just did this on my Mac OS X 10.9.4 system with perl 5.18.2:
> > >>
> > >> cd tmp
> > >> mkdir haiyan
> > >> cd haiyan
> > >> cpanm -n -L local Bio::SeqIO
> > >>
> > >> perl -Ilocal/lib/perl5 foo.pl
> > >>
> > >> With the following little program in foo.pl:
> > >>
> > >> use Bio::SeqIO ;
> > >>
> > >> my $in = Bio::SeqIO->new(-format=>"Fasta", -fh => \*DATA);
> > >> while(my $s = $in->next_seq()){
> > >>    print "seq is " . $s->seq . "\n"
> > >> }
> > >>
> > >> __DATA__
> > >>> ct1
> > >> AGAGAGAGA
> > >>> ctg2
> > >> ATATATAT
> > >>
> > >> and it does this when I run it:
> > >>
> > >> (alacrity)[18:22:58]haiyan>>perl -Ilocal/lib/perl5 foo.pl
> > >> seq is AGAGAGAGA
> > >> seq is ATATATAT
> > >> (alacrity)[18:24:42]haiyan>>
> > >>
> > >> Can you get the same series of things to work?
> > >>
> > >> If you’re doing a bunch of this kind of stuff, you might want to look
> > >> at Data::Section; rjbs discusses it
> > >> here. It’s warmer and fuzzier than dealing with the DATA handle by
> > >> yourself.
> > >>
> > >> g.
> > >>
> > >> ​
> > >
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l at mailman.open-bio.org
> > > http://mailman.open-bio.org/mailman/listinfo/bioperl-l
> >
>
>
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.open-bio.org/pipermail/bioperl-l/attachments/20140714/fc64af12/attachment.html>