[Bioperl-l] use Bio::SeqIO to read Fasta sequence from pipe, or @ARGV, like "while (<>) {....}"

[Fields, Christopher J]

Haiyan,

Do you want a test script that uses the DATA handle or a script that can pull in data from STDIN (e.g. from outside)?  They are not the same.  It’s possible to do both but I think you’re conflating purposes here; someone using this script might not expect it to behave both ways.

chris

On Jul 12, 2014, at 9:23 PM, Haiyan Lin <linhy0120 at gmail.com> wrote:

> Hi, geogre,
> 
> Thanks your code is working for data embedded in code with "__DATA__".
> But, it failed to hand data from outside. Following is the data and
> result.
> 
> [linhy at bioinfo1 Script]$ more try.fa
>> Contig000001
> CCACGTAAGAGCACCTGGGTCCCCGCCCGCCAAGCGCCGCGAGCGCCAGCAGCAGCTCGC
>> hello
> ATATATTTTT
> [linhy at bioinfo1 Script]$ cat try.fa | perl try.pl 
> seq is AGAGAGAGA
> seq is ATATATAT
> 
> Thanks
> 
> Haiyan
> 
> 
> 
> On Sat, 2014-07-12 at 18:36 -0700, george hartzell wrote:
>> I just did this on my Mac OS X 10.9.4 system with perl 5.18.2:
>> 
>> cd tmp
>> mkdir haiyan
>> cd haiyan
>> cpanm -n -L local Bio::SeqIO
>> 
>> perl -Ilocal/lib/perl5 foo.pl
>> 
>> With the following little program in foo.pl:
>> 
>> use Bio::SeqIO ;
>> 
>> my $in = Bio::SeqIO->new(-format=>"Fasta", -fh => \*DATA);
>> while(my $s = $in->next_seq()){
>>    print "seq is " . $s->seq . "\n"
>> }
>> 
>> __DATA__
>>> ct1
>> AGAGAGAGA
>>> ctg2
>> ATATATAT
>> 
>> and it does this when I run it:
>> 
>> (alacrity)[18:22:58]haiyan>>perl -Ilocal/lib/perl5 foo.pl
>> seq is AGAGAGAGA
>> seq is ATATATAT
>> (alacrity)[18:24:42]haiyan>>
>> 
>> Can you get the same series of things to work?
>> 
>> If you’re doing a bunch of this kind of stuff, you might want to look
>> at Data::Section; rjbs discusses it
>> here. It’s warmer and fuzzier than dealing with the DATA handle by
>> yourself.
>> 
>> g.
>> 
>> ​
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/bioperl-l