[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.

Francisco J. Ossandón fossandonc at hotmail.com
Wed Jan 25 19:41:33 UTC 2012


Hello,
Is possible to get just the best hit using a Label in the Results cycle and
then using a 'next LABEL' command.
http://perldoc.perl.org/perlsyn.html#Loop-Control
http://perldoc.perl.org/functions/next.html

Below is the script with the added Label, tested and working. I added back
the $hsp loop so you can optionally see everything again just commenting out
the "next RESULT;" line.

#####
#!/usr/bin/perl
use strict;
use warnings;
use Bio::SearchIO;

my $blast_report = 'blast.out.txt';
my $searchio = Bio::SearchIO->new(-file   => $blast_report,
                                  -format => 'blast');

RESULT:
while ( my $result = $searchio->next_result ) {
    my $QueryName     = $result->query_name;
    my $QueryDescript = $result->query_description;
    my $QueryLength   = $result->query_length;
    my $NoHits        = $result->num_hits;

    while( my $hit = $result->next_hit ) {
        my $HitName    = $hit->name;
        my $HitDescrip = $hit->description;
        my $HitLength  = $hit->length;
        my $Score      = $hit->raw_score;
        my $Bits       = $hit->bits;

        while( my $hsp    = $hit->next_hsp ) {
            my $Evalue = $hsp->evalue;
            my $AlnLen = $hsp->num_identical;
            my $TotalLen    = $hsp->hsp_length;
            my $QueryStrand = $hsp->strand('query');
            my $HitStrand   = $hsp->strand('hit');
    
            #if($Evalue < $cutoff){
                print "$QueryName $QueryDescript\t";
                print "$QueryLength\t";
                print "$NoHits\t";
                print "$HitName $HitDescrip\t";
                print "$HitLength\t";
                print "$Score\t";
                print "$Bits\t";
                print "$Evalue\n";
                print "$AlnLen\t";
                print "$TotalLen\t";
                print "$QueryStrand\t";
                print "$HitStrand\n";
            #}
            next RESULT;
        }
    }
    #print "\n";
}
exit;
#####

Cheers,

Francisco J. Ossandon

-----Mensaje original-----
De: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] En nombre de Frank Schwach
Enviado el: miércoles, 25 de enero de 2012 12:15
Para: kakchingtabam pawankumar sharma
CC: <bioperl-l at bioperl.org>
Asunto: Re: [Bioperl-l] how to get the information of Strand = Plus / Plus
from blastn report by bioperl.

ah, sorry, my bad: the parameter name for the constructor appears to
actually be just 'best'
so you can try:
my $searchio = new Bio::SearchIO( -format =>  'blast', -file  =>
$blast_report, -best =>   1);

but to set this flag later or ask if it is set you do for example

print "analysing best hit only " if $searchio->best_hit_only;

bit confusing but should work.

Frank



On 25/01/12 14:41, kakchingtabam pawankumar sharma wrote:
> Hi,
>
> This is my script:-
>
> my $searchio = new Bio::SearchIO( -format =>  'blast', -file  =>
> $blast_report, -best_hit_only =>   1);
>
> while ( my $result = $searchio->next_result() ) {
>
>      my $QueryName = $result->query_name(); my $QueryDescript = 
> $result->query_description();
>      my $QueryLength = $result->query_length;
>      my $NoHits = $result->num_hits;
>
>      while( my $hit = $result->next_hit ) {
>          my $HitName = $hit->name();
>          my $HitDescrip = $hit->description();
> 	my $HitLength = $hit->length;
>          my $Score = $hit->raw_score();
> 	my $Bits = $hit->bits;
>
>          my $hsp = $hit->next_hsp; # Only check first (= best) hsp
> 	my $Evalue =  $hsp->evalue();
> 	my $AlnLen = $hsp->num_identical();
> 	my $TotalLen = $hsp->hsp_length;
> 	my $QueryStrand = $hsp->strand('query');
> 	my $HitStrand = $hsp->strand('hit');
>
> 	#if($Evalue<  $cutoff){
> 	    print "$QueryName $QueryDescript\t";
> 	    print "$QueryLength\t";
> 	    print "$NoHits\t";
> 	    print "$HitName $HitDescrip\t";
> 	    print "$HitLength\t";
> 	    print "$Score\t";
> 	    print "$Bits\t";
> 	    print "$Evalue\n";
> 	    print "$AlnLen\t";
> 	    print "$TotalLen\t";
> 	    print "$QueryStrand\t";
> 	    print "$HitStrand\n";
> 	#}
>      }
>      #print "\n";
> }
>
>
> So Can You Predict where I need to modify This Script To get only 
> tophit of every Query.
>
> With Regards,
> Pawan
>
> On 1/25/12, Frank Schwach<fs5 at sanger.ac.uk>  wrote:
>> can you post your script please?
>>
>> On 25/01/12 07:12, kakchingtabam pawankumar sharma wrote:
>>> Hi Frank,
>>> Thanks for your kind reply. I have done this in my script even 
>>> though i could get the top hit still for every query. Still all hits 
>>> are extracted by my script. So kindly help me to solve this problem.
>>>
>>> With best regards,
>>> Pawan
>>>
>>> On Tue, Jan 24, 2012 at 5:13 PM, Frank Schwach<fs5 at sanger.ac.uk>
wrote:
>>>> I think that's an option that you can set when you ask for a new 
>>>> BLAST
>>>> parser:
>>>> my $searchio = new Bio::SearchIO(
>>>>    -format =>   'blast',
>>>>    -file   =>   't/data/ecolitst.bls',
>>>>    -best_hit_only =>   1,
>>>> );
>>>>
>>>> now when you use the same script that you have been using so far 
>>>> (loop over all hits), there will only be one hit per result.
>>>>
>>>> Frank
>>>>
>>>>
>>>>
>>>> On 24/01/12 11:31, kakchingtabam pawankumar sharma wrote:
>>>>>
>>>>> Hi,
>>>>>         Thanks a lot for help Frank. It works for every Blast output.
>>>>> One more question is that i want to best hit only(top hit of every 
>>>>> query).
>>>>> I show there is option called
>>>>> $obj->best_hit_only; in Bio::SearchIO module.
>>>>> So help to add this to my script.
>>>>> I could not do. Its confusing.
>>>>>
>>>>> Thanks in Advanced.
>>>>>
>>>>> With best regards,
>>>>> Pawan
>>>>>
>>>>>
>>>>> On Mon, Jan 16, 2012 at 9:05 PM, Frank Schwach<fs5 at sanger.ac.uk>
>>>>> wrote:
>>>>>>
>>>>>> Excellent, well done!
>>>>>> No, this is the way to do it. In BioPerl modules that use strand 
>>>>>> information you will find the values +1/-1 or undef. If you want 
>>>>>> to display those as PLUS/MINUS,+/-,Watson/Crick,Laurel/Hardy 
>>>>>> whatever, you have to convert it, but you know now how to do it.
>>>>>> You have a syntax error in your code where you retrieve the query
name:
>>>>>>
>>>>>>
>>>>>> my $QueryName = $result->query_name(), my $QueryDescript = 
>>>>>> $result->query_description();
>>>>>>
>>>>>> should be two lines and the comma should be a semicolon.
>>>>>>
>>>>>> Good luck!
>>>>>>
>>>>>> Frank
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>> On 16/01/12 15:14, kakchingtabam pawankumar sharma wrote:
>>>>>>>
>>>>>>>
>>>>>>> So By using the if else conditon function, I have solve Frank.
>>>>>>> I mean is there anyway in bioperl we can get directly using 
>>>>>>> other module! I hope u got it!
>>>>>>>
>>>>>>>
>>>>>>> So my second Question have not replied that is
>>>>>>>
>>>>>>> i have blastn report as below:
>>>>>>>
>>>>>>> BLASTN 2.2.18 [Mar-02-2008]
>>>>>>>
>>>>>>>
>>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>>> Schaffer,
>>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman 
>>>>>>> (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein 
>>>>>>> database search programs",  Nucleic Acids Res. 25:3389-3402.
>>>>>>>
>>>>>>> Query= ORB_1210001_hsa-miR-548aa#5_1
>>>>>>>           (24 letters)
>>>>>>>
>>>>>>> Database: hsa-mmu-rno_miRNA.fa
>>>>>>>             3524 sequences; 76,424 total letters
>>>>>>>
>>>>>>> Searching..................................................done
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>
Score
>>>>>>>    E
>>>>>>> Sequences producing significant alignments:
>>>>>>> (bits)
>>>>>>> Value
>>>>>>>
>>>>>>> hsa-miR-548aa
>>>>>>> 48   2e-009
>>>>>>> hsa-miR-548d-5p
>>>>>>> 36   9e-006
>>>>>>> hsa-miR-548b-5p
>>>>>>> 36   9e-006
>>>>>>> hsa-miR-548z
>>>>>>> 34   3e-005
>>>>>>> hsa-miR-548q
>>>>>>> 30   5e-004
>>>>>>> hsa-miR-548n
>>>>>>> 30   5e-004
>>>>>>> hsa-miR-548ab
>>>>>>> 28   0.002
>>>>>>> hsa-miR-548v
>>>>>>> 28   0.002
>>>>>>> hsa-miR-548c-5p
>>>>>>> 28   0.002
>>>>>>> hsa-miR-548ag
>>>>>>> 26   0.008
>>>>>>> hsa-miR-548u
>>>>>>> 26   0.008
>>>>>>> hsa-miR-548c-3p
>>>>>>> 26   0.008
>>>>>>> hsa-miR-603
>>>>>>> 26   0.008
>>>>>>> hsa-miR-548a-3p
>>>>>>> 26   0.008
>>>>>>> hsa-miR-548ac
>>>>>>> 24   0.033
>>>>>>> hsa-miR-548an
>>>>>>> 22   0.13
>>>>>>> hsa-miR-548aj
>>>>>>> 22   0.13
>>>>>>> hsa-miR-548i
>>>>>>> 22   0.13
>>>>>>> hsa-miR-548g
>>>>>>> 22   0.13
>>>>>>> hsa-miR-548j
>>>>>>> 22   0.13
>>>>>>> hsa-miR-548a-5p
>>>>>>> 22   0.13
>>>>>>>
>>>>>>>> hsa-miR-548aa
>>>>>>>
>>>>>>>
>>>>>>>            Length = 25
>>>>>>>
>>>>>>>    Score = 48.1 bits (24), Expect = 2e-009
>>>>>>>    Identities = 24/24 (100%)
>>>>>>>    Strand = Plus / Minus
>>>>>>>
>>>>>>>
>>>>>>> Query: 1  tggtgcaaaagtaattgtggtttt 24
>>>>>>>            ||||||||||||||||||||||||
>>>>>>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>>>>>>
>>>>>>>
>>>>>>>> hsa-miR-548d-5p
>>>>>>>
>>>>>>>
>>>>>>>            Length = 22
>>>>>>>
>>>>>>>    Score = 36.2 bits (18), Expect = 9e-006
>>>>>>>    Identities = 18/18 (100%)
>>>>>>>    Strand = Plus / Plus
>>>>>>>
>>>>>>>
>>>>>>> Query: 7  aaaagtaattgtggtttt 24
>>>>>>>            ||||||||||||||||||
>>>>>>> Sbjct: 1  aaaagtaattgtggtttt 18
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> in this result i could not parse my code. i think my code does 
>>>>>>> not accept the Query header that is 
>>>>>>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example 
>>>>>>> blast output.
>>>>>>>
>>>>>>> kindly help me out.
>>>>>>>
>>>>>>> with regards,
>>>>>>> Pawan.
>>>>>>>
>>>>>>> On 1/16/12, Frank Schwach<fs5 at sanger.ac.uk>       wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>> Hi Pawan ,
>>>>>>>>
>>>>>>>> Please always "reply to all", so that you keep the discussion 
>>>>>>>> on the bioperl mailing list and more people can help you.
>>>>>>>> What you need is a very basic Perl command. I could give you 
>>>>>>>> the code but I think you get more out of it if you experiment 
>>>>>>>> with it on your own because it is very fundamental. I'll point 
>>>>>>>> you in the right
>>>>>>>> direction:
>>>>>>>> you want an if-then-else conditional construct.
>>>>>>>>
>>>>>>>> Perl's documentation about this is here:
>>>>>>>>
>>>>>>>> http://perldoc.perl.org/perlintro.html#Conditional-and-looping-
>>>>>>>> constructs
>>>>>>>>
>>>>>>>> if strand is 1 you want to print "PLUS" else if it is -1 you 
>>>>>>>> want to print "MINUS", or else you might want to print "no 
>>>>>>>> strand" or something, or even treat it as an error and make the 
>>>>>>>> script abort.
>>>>>>>>
>>>>>>>> Give it a go and let us know if you need help. For basic 
>>>>>>>> (non-bio) Perl question, please also check out the community at 
>>>>>>>> http://www.perlmonks.org/.
>>>>>>>>
>>>>>>>> Hope that helps,
>>>>>>>>
>>>>>>>> Frank
>>>>>>>>
>>>>>>>>
>>>>>>>> On 14/01/12 05:59, kakchingtabam pawankumar sharma wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Hi frank,
>>>>>>>>>
>>>>>>>>> Thanks for your kind reply.
>>>>>>>>> I could get the vale for query as 1 value if it is plus.
>>>>>>>>> and for hit = -1 if it is minus.
>>>>>>>>> But i would like to print out as PLUS or MINUS not 1 or -1 my 
>>>>>>>>> friend.
>>>>>>>>>
>>>>>>>>> you can see my code as below:
>>>>>>>>>
>>>>>>>>> while ( my $result = $searchio->next_result() ) {
>>>>>>>>>        my $QueryName = $result->query_name(), my 
>>>>>>>>> $QueryDescript = $result->query_description();
>>>>>>>>>        my $QueryLength = $result->query_length;
>>>>>>>>>        my $NoHits = $result->num_hits;
>>>>>>>>>
>>>>>>>>>        while( my $hit = $result->next_hit ) {
>>>>>>>>>            my $HitName = $hit->name();
>>>>>>>>>            my $HitDescrip = $hit->description();
>>>>>>>>>          my $HitLength = $hit->length;
>>>>>>>>>            my $Score = $hit->raw_score();
>>>>>>>>>          my $Bits = $hit->bits;
>>>>>>>>>
>>>>>>>>>            my $hsp = $hit->next_hsp; # Only check first (= best)
hsp
>>>>>>>>>          my $Evalue =  $hsp->evalue();
>>>>>>>>>          my $AlnLen = $hsp->num_identical();
>>>>>>>>>          my $TotalLen = $hsp->hsp_length;
>>>>>>>>>          my $QueryStrand = $hsp->strand('query');
>>>>>>>>>          my $HitStrand = $hsp->strand('hit');
>>>>>>>>>
>>>>>>>>>          if($Evalue<        $cutoff){
>>>>>>>>>              print "$QueryName $QueryDescript\t";
>>>>>>>>>              print "$QueryLength\t";
>>>>>>>>>              print "$NoHits\t";
>>>>>>>>>              print "$HitName $HitDescrip\t";
>>>>>>>>>              print "$HitLength\t";
>>>>>>>>>              print "$Score\t";
>>>>>>>>>              print "$Bits\t";
>>>>>>>>>              print "$Evalue\t";
>>>>>>>>>              print "$AlnLen\t";
>>>>>>>>>              print "$TotalLen\t";
>>>>>>>>>              print "$QueryStrand\t";
>>>>>>>>>              print "$HitStrand\n";
>>>>>>>>>          }
>>>>>>>>>        }
>>>>>>>>>        print "\n";
>>>>>>>>> }
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> This is a part of my code.
>>>>>>>>>
>>>>>>>>> i have blastn report as below:
>>>>>>>>>
>>>>>>>>> BLASTN 2.2.18 [Mar-02-2008]
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>>>>> Schaffer,
>>>>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman 
>>>>>>>>> (1997), "Gapped BLAST and PSI-BLAST: a new generation of 
>>>>>>>>> protein database search programs",  Nucleic Acids Res. 
>>>>>>>>> 25:3389-3402.
>>>>>>>>>
>>>>>>>>> Query= ORB_1210001_hsa-miR-548aa#5_1
>>>>>>>>>             (24 letters)
>>>>>>>>>
>>>>>>>>> Database: hsa-mmu-rno_miRNA.fa
>>>>>>>>>               3524 sequences; 76,424 total letters
>>>>>>>>>
>>>>>>>>> Searching..................................................don
>>>>>>>>> e
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Score
>>>>>>>>> E
>>>>>>>>> Sequences producing significant alignments:
>>>>>>>>>    (bits)
>>>>>>>>> Value
>>>>>>>>>
>>>>>>>>> hsa-miR-548aa
>>>>>>>>> 48   2e-009
>>>>>>>>> hsa-miR-548d-5p
>>>>>>>>> 36   9e-006
>>>>>>>>> hsa-miR-548b-5p
>>>>>>>>> 36   9e-006
>>>>>>>>> hsa-miR-548z
>>>>>>>>> 34   3e-005
>>>>>>>>> hsa-miR-548q
>>>>>>>>> 30   5e-004
>>>>>>>>> hsa-miR-548n
>>>>>>>>> 30   5e-004
>>>>>>>>> hsa-miR-548ab
>>>>>>>>> 28   0.002
>>>>>>>>> hsa-miR-548v
>>>>>>>>> 28   0.002
>>>>>>>>> hsa-miR-548c-5p
>>>>>>>>> 28   0.002
>>>>>>>>> hsa-miR-548ag
>>>>>>>>> 26   0.008
>>>>>>>>> hsa-miR-548u
>>>>>>>>> 26   0.008
>>>>>>>>> hsa-miR-548c-3p
>>>>>>>>> 26   0.008
>>>>>>>>> hsa-miR-603
>>>>>>>>> 26   0.008
>>>>>>>>> hsa-miR-548a-3p
>>>>>>>>> 26   0.008
>>>>>>>>> hsa-miR-548ac
>>>>>>>>> 24   0.033
>>>>>>>>> hsa-miR-548an
>>>>>>>>> 22   0.13
>>>>>>>>> hsa-miR-548aj
>>>>>>>>> 22   0.13
>>>>>>>>> hsa-miR-548i
>>>>>>>>> 22   0.13
>>>>>>>>> hsa-miR-548g
>>>>>>>>> 22   0.13
>>>>>>>>> hsa-miR-548j
>>>>>>>>> 22   0.13
>>>>>>>>> hsa-miR-548a-5p
>>>>>>>>> 22   0.13
>>>>>>>>>
>>>>>>>>>> hsa-miR-548aa
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>              Length = 25
>>>>>>>>>
>>>>>>>>>     Score = 48.1 bits (24), Expect = 2e-009
>>>>>>>>>     Identities = 24/24 (100%)
>>>>>>>>>     Strand = Plus / Minus
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Query: 1  tggtgcaaaagtaattgtggtttt 24
>>>>>>>>>              ||||||||||||||||||||||||
>>>>>>>>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> hsa-miR-548d-5p
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>              Length = 22
>>>>>>>>>
>>>>>>>>>     Score = 36.2 bits (18), Expect = 9e-006
>>>>>>>>>     Identities = 18/18 (100%)
>>>>>>>>>     Strand = Plus / Plus
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Query: 7  aaaagtaattgtggtttt 24
>>>>>>>>>              ||||||||||||||||||
>>>>>>>>> Sbjct: 1  aaaagtaattgtggtttt 18
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> in this result i could not parse my code. i think my code does 
>>>>>>>>> not accept the Query header that is 
>>>>>>>>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example 
>>>>>>>>> blast output.
>>>>>>>>>
>>>>>>>>> kindly help me out.
>>>>>>>>>
>>>>>>>>> with regards,
>>>>>>>>> Pawan.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> On Sat, Jan 14, 2012 at 3:13 AM, Frank 
>>>>>>>>> Schwach<fs5 at sanger.ac.uk>
>>>>>>>>> wrote:
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> Hi Pawan,
>>>>>>>>>>
>>>>>>>>>> Can you show your code? Is it basically following the 
>>>>>>>>>> structure shown in 
>>>>>>>>>> http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
>>>>>>>>>> ?
>>>>>>>>>>
>>>>>>>>>> If that is the case
>>>>>>>>>>
>>>>>>>>>> $hsp->strand('query')
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> is exactly what you need.
>>>>>>>>>> To check if hit and query are on different strands you can do:
>>>>>>>>>>
>>>>>>>>>> if ( $hsp->strand('query')
>>>>>>>>>> * $hsp->strand('hit') == -1){
>>>>>>>>>>
>>>>>>>>>>     # do whatever you need to do if they are on opposite 
>>>>>>>>>> strands
>>>>>>>>>>
>>>>>>>>>> }
>>>>>>>>>>
>>>>>>>>>> Hope that helps
>>>>>>>>>>
>>>>>>>>>> Frank
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Hi,
>>>>>>>>>>>                 Using Bio::SearchIO module I am parsing the 
>>>>>>>>>>> following Blast result.
>>>>>>>>>>> I have used the option- $hsp->strand('query').
>>>>>>>>>>>
>>>>>>>>>>> But I cannot get detail of alignment.
>>>>>>>>>>>
>>>>>>>>>>> I need to know if my hit is forward (Strand = Plus / Plus) 
>>>>>>>>>>> or reverse ( Strand = Plus / Minus)...
>>>>>>>>>>>     Can anyone help me to get report as Plus or Minus for 
>>>>>>>>>>> query  or hit.
>>>>>>>>>>>
>>>>>>>>>>> thanks in advanced.
>>>>>>>>>>>
>>>>>>>>>>> With regards,
>>>>>>>>>>> Pawan
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> BLASTN 2.2.18 [Dec-23-2011]
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>>>>>>> Schaffer,
>>>>>>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman 
>>>>>>>>>>> (1997), "Gapped BLAST and PSI-BLAST: a new generation of 
>>>>>>>>>>> protein database search programs",  Nucleic Acids Res. 
>>>>>>>>>>> 25:3389-3402.
>>>>>>>>>>>
>>>>>>>>>>> Query= 000013_c10079-9984
>>>>>>>>>>>             (50 letters)
>>>>>>>>>>>
>>>>>>>>>>> Database: Cyano_Probe.fasta
>>>>>>>>>>>               4760 sequences; 238,000 total letters
>>>>>>>>>>>
>>>>>>>>>>> Searching..................................................d
>>>>>>>>>>> one
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Score
>>>>>>>>>>>     E
>>>>>>>>>>> Sequences producing significant alignments:
>>>>>>>>>>>    (bits)
>>>>>>>>>>> Value
>>>>>>>>>>>
>>>>>>>>>>> 000013_c10079-9984
>>>>>>>>>>> 100   7e-024
>>>>>>>>>>> 002619_2689273-2690037
>>>>>>>>>>> 24   0.36
>>>>>>>>>>> 001126_c1123720-1123385
>>>>>>>>>>> 24   0.36
>>>>>>>>>>> 003211_c3326737-3326480
>>>>>>>>>>> 22   1.4
>>>>>>>>>>> 002415_2471082-2471420
>>>>>>>>>>> 22   1.4
>>>>>>>>>>> 002269_2321276-2322463
>>>>>>>>>>> 22   1.4
>>>>>>>>>>> 001328_c1326535-1326164
>>>>>>>>>>> 22   1.4
>>>>>>>>>>>
>>>>>>>>>>>> 000013_c10079-9984
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>              Length = 50
>>>>>>>>>>>
>>>>>>>>>>>     Score = 99.6 bits (50), Expect = 7e-024
>>>>>>>>>>>     Identities = 50/50 (100%)
>>>>>>>>>>>     Strand = Plus / Plus
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Query: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>>>>>>>>              
>>>>>>>>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||
>>>>>>>>>>> Sbjct: 1  agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 
>>>>>>>>>>> 50
>>>>>>>>>>>
>>>>>>>>>>> _______________________________________________
>>>>>>>>>>> Bioperl-l mailing list
>>>>>>>>>>> Bioperl-l at lists.open-bio.org 
>>>>>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> --
>>>>>>>>>> The Wellcome Trust Sanger Institute is operated by Genome 
>>>>>>>>>> Research Limited, a charity registered in England with number 
>>>>>>>>>> 1021457 and a company registered in England with number 
>>>>>>>>>> 2742969, whose registered office is 215 Euston Road, London, 
>>>>>>>>>> NW1 2BE.
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> --
>>>>>>>>    The Wellcome Trust Sanger Institute is operated by Genome
Research
>>>>>>>>    Limited, a charity registered in England with number 1021457 and
a
>>>>>>>>    company registered in England with number 2742969, whose
registered
>>>>>>>>    office is 215 Euston Road, London, NW1 2BE.
>>>>>>>>
>>>>>>
>>>>>>
>>>>>> --
>>>>>> The Wellcome Trust Sanger Institute is operated by Genome 
>>>>>> Research Limited, a charity registered in England with number 
>>>>>> 1021457 and a company registered in England with number 2742969, 
>>>>>> whose registered office is 215 Euston Road, London, NW1 2BE.
>>>>
>>>>
>>>>
>>>> --
>>>> The Wellcome Trust Sanger Institute is operated by Genome Research 
>>>> Limited, a charity registered in England with number 1021457 and a 
>>>> company registered in England with number 2742969, whose registered 
>>>> office is 215 Euston Road, London, NW1 2BE.
>>
>>
>> --
>>   The Wellcome Trust Sanger Institute is operated by Genome Research
>>   Limited, a charity registered in England with number 1021457 and a
>>   company registered in England with number 2742969, whose registered
>>   office is 215 Euston Road, London, NW1 2BE.
>>


--
 The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a  company
registered in England with number 2742969, whose registered  office is 215
Euston Road, London, NW1 2BE. 
_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l





More information about the Bioperl-l mailing list