[Bioperl-l] how to get the information of Strand = Plus / Plus from blastn report by bioperl.
Frank Schwach
fs5 at sanger.ac.uk
Wed Jan 25 15:15:27 UTC 2012
ah, sorry, my bad: the parameter name for the constructor appears to
actually be just 'best'
so you can try:
my $searchio = new Bio::SearchIO( -format => 'blast', -file =>
$blast_report, -best => 1);
but to set this flag later or ask if it is set you do for example
print "analysing best hit only " if $searchio->best_hit_only;
bit confusing but should work.
Frank
On 25/01/12 14:41, kakchingtabam pawankumar sharma wrote:
> Hi,
>
> This is my script:-
>
> my $searchio = new Bio::SearchIO( -format => 'blast', -file =>
> $blast_report, -best_hit_only => 1);
>
> while ( my $result = $searchio->next_result() ) {
>
> my $QueryName = $result->query_name(); my $QueryDescript =
> $result->query_description();
> my $QueryLength = $result->query_length;
> my $NoHits = $result->num_hits;
>
> while( my $hit = $result->next_hit ) {
> my $HitName = $hit->name();
> my $HitDescrip = $hit->description();
> my $HitLength = $hit->length;
> my $Score = $hit->raw_score();
> my $Bits = $hit->bits;
>
> my $hsp = $hit->next_hsp; # Only check first (= best) hsp
> my $Evalue = $hsp->evalue();
> my $AlnLen = $hsp->num_identical();
> my $TotalLen = $hsp->hsp_length;
> my $QueryStrand = $hsp->strand('query');
> my $HitStrand = $hsp->strand('hit');
>
> #if($Evalue< $cutoff){
> print "$QueryName $QueryDescript\t";
> print "$QueryLength\t";
> print "$NoHits\t";
> print "$HitName $HitDescrip\t";
> print "$HitLength\t";
> print "$Score\t";
> print "$Bits\t";
> print "$Evalue\n";
> print "$AlnLen\t";
> print "$TotalLen\t";
> print "$QueryStrand\t";
> print "$HitStrand\n";
> #}
> }
> #print "\n";
> }
>
>
> So Can You Predict where I need to modify This Script To get only
> tophit of every Query.
>
> With Regards,
> Pawan
>
> On 1/25/12, Frank Schwach<fs5 at sanger.ac.uk> wrote:
>> can you post your script please?
>>
>> On 25/01/12 07:12, kakchingtabam pawankumar sharma wrote:
>>> Hi Frank,
>>> Thanks for your kind reply. I have done this in my script even though
>>> i could get the top hit still for every query. Still all hits are
>>> extracted by my script. So kindly help me to solve this problem.
>>>
>>> With best regards,
>>> Pawan
>>>
>>> On Tue, Jan 24, 2012 at 5:13 PM, Frank Schwach<fs5 at sanger.ac.uk> wrote:
>>>> I think that's an option that you can set when you ask for a new BLAST
>>>> parser:
>>>> my $searchio = new Bio::SearchIO(
>>>> -format => 'blast',
>>>> -file => 't/data/ecolitst.bls',
>>>> -best_hit_only => 1,
>>>> );
>>>>
>>>> now when you use the same script that you have been using so far (loop
>>>> over
>>>> all hits), there will only be one hit per result.
>>>>
>>>> Frank
>>>>
>>>>
>>>>
>>>> On 24/01/12 11:31, kakchingtabam pawankumar sharma wrote:
>>>>>
>>>>> Hi,
>>>>> Thanks a lot for help Frank. It works for every Blast output.
>>>>> One more question is that i want to best hit only(top hit of every
>>>>> query).
>>>>> I show there is option called
>>>>> $obj->best_hit_only; in Bio::SearchIO module.
>>>>> So help to add this to my script.
>>>>> I could not do. Its confusing.
>>>>>
>>>>> Thanks in Advanced.
>>>>>
>>>>> With best regards,
>>>>> Pawan
>>>>>
>>>>>
>>>>> On Mon, Jan 16, 2012 at 9:05 PM, Frank Schwach<fs5 at sanger.ac.uk>
>>>>> wrote:
>>>>>>
>>>>>> Excellent, well done!
>>>>>> No, this is the way to do it. In BioPerl modules that use strand
>>>>>> information
>>>>>> you will find the values +1/-1 or undef. If you want to display those
>>>>>> as
>>>>>> PLUS/MINUS,+/-,Watson/Crick,Laurel/Hardy whatever, you have to convert
>>>>>> it,
>>>>>> but you know now how to do it.
>>>>>> You have a syntax error in your code where you retrieve the query name:
>>>>>>
>>>>>>
>>>>>> my $QueryName = $result->query_name(), my $QueryDescript =
>>>>>> $result->query_description();
>>>>>>
>>>>>> should be two lines and the comma should be a semicolon.
>>>>>>
>>>>>> Good luck!
>>>>>>
>>>>>> Frank
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>> On 16/01/12 15:14, kakchingtabam pawankumar sharma wrote:
>>>>>>>
>>>>>>>
>>>>>>> So By using the if else conditon function, I have solve Frank.
>>>>>>> I mean is there anyway in bioperl we can get directly using other
>>>>>>> module! I hope u got it!
>>>>>>>
>>>>>>>
>>>>>>> So my second Question have not replied that is
>>>>>>>
>>>>>>> i have blastn report as below:
>>>>>>>
>>>>>>> BLASTN 2.2.18 [Mar-02-2008]
>>>>>>>
>>>>>>>
>>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>>> Schaffer,
>>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>>>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database
>>>>>>> search
>>>>>>> programs", Nucleic Acids Res. 25:3389-3402.
>>>>>>>
>>>>>>> Query= ORB_1210001_hsa-miR-548aa#5_1
>>>>>>> (24 letters)
>>>>>>>
>>>>>>> Database: hsa-mmu-rno_miRNA.fa
>>>>>>> 3524 sequences; 76,424 total letters
>>>>>>>
>>>>>>> Searching..................................................done
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> Score
>>>>>>> E
>>>>>>> Sequences producing significant alignments:
>>>>>>> (bits)
>>>>>>> Value
>>>>>>>
>>>>>>> hsa-miR-548aa
>>>>>>> 48 2e-009
>>>>>>> hsa-miR-548d-5p
>>>>>>> 36 9e-006
>>>>>>> hsa-miR-548b-5p
>>>>>>> 36 9e-006
>>>>>>> hsa-miR-548z
>>>>>>> 34 3e-005
>>>>>>> hsa-miR-548q
>>>>>>> 30 5e-004
>>>>>>> hsa-miR-548n
>>>>>>> 30 5e-004
>>>>>>> hsa-miR-548ab
>>>>>>> 28 0.002
>>>>>>> hsa-miR-548v
>>>>>>> 28 0.002
>>>>>>> hsa-miR-548c-5p
>>>>>>> 28 0.002
>>>>>>> hsa-miR-548ag
>>>>>>> 26 0.008
>>>>>>> hsa-miR-548u
>>>>>>> 26 0.008
>>>>>>> hsa-miR-548c-3p
>>>>>>> 26 0.008
>>>>>>> hsa-miR-603
>>>>>>> 26 0.008
>>>>>>> hsa-miR-548a-3p
>>>>>>> 26 0.008
>>>>>>> hsa-miR-548ac
>>>>>>> 24 0.033
>>>>>>> hsa-miR-548an
>>>>>>> 22 0.13
>>>>>>> hsa-miR-548aj
>>>>>>> 22 0.13
>>>>>>> hsa-miR-548i
>>>>>>> 22 0.13
>>>>>>> hsa-miR-548g
>>>>>>> 22 0.13
>>>>>>> hsa-miR-548j
>>>>>>> 22 0.13
>>>>>>> hsa-miR-548a-5p
>>>>>>> 22 0.13
>>>>>>>
>>>>>>>> hsa-miR-548aa
>>>>>>>
>>>>>>>
>>>>>>> Length = 25
>>>>>>>
>>>>>>> Score = 48.1 bits (24), Expect = 2e-009
>>>>>>> Identities = 24/24 (100%)
>>>>>>> Strand = Plus / Minus
>>>>>>>
>>>>>>>
>>>>>>> Query: 1 tggtgcaaaagtaattgtggtttt 24
>>>>>>> ||||||||||||||||||||||||
>>>>>>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>>>>>>
>>>>>>>
>>>>>>>> hsa-miR-548d-5p
>>>>>>>
>>>>>>>
>>>>>>> Length = 22
>>>>>>>
>>>>>>> Score = 36.2 bits (18), Expect = 9e-006
>>>>>>> Identities = 18/18 (100%)
>>>>>>> Strand = Plus / Plus
>>>>>>>
>>>>>>>
>>>>>>> Query: 7 aaaagtaattgtggtttt 24
>>>>>>> ||||||||||||||||||
>>>>>>> Sbjct: 1 aaaagtaattgtggtttt 18
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> in this result i could not parse my code. i think my code does not
>>>>>>> accept the Query header that is
>>>>>>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast
>>>>>>> output.
>>>>>>>
>>>>>>> kindly help me out.
>>>>>>>
>>>>>>> with regards,
>>>>>>> Pawan.
>>>>>>>
>>>>>>> On 1/16/12, Frank Schwach<fs5 at sanger.ac.uk> wrote:
>>>>>>>>
>>>>>>>>
>>>>>>>> Hi Pawan ,
>>>>>>>>
>>>>>>>> Please always "reply to all", so that you keep the discussion on the
>>>>>>>> bioperl mailing list and more people can help you.
>>>>>>>> What you need is a very basic Perl command. I could give you the code
>>>>>>>> but I think you get more out of it if you experiment with it on your
>>>>>>>> own
>>>>>>>> because it is very fundamental. I'll point you in the right
>>>>>>>> direction:
>>>>>>>> you want an if-then-else conditional construct.
>>>>>>>>
>>>>>>>> Perl's documentation about this is here:
>>>>>>>>
>>>>>>>> http://perldoc.perl.org/perlintro.html#Conditional-and-looping-constructs
>>>>>>>>
>>>>>>>> if strand is 1 you want to print "PLUS" else if it is -1 you want to
>>>>>>>> print "MINUS", or else you might want to print "no strand" or
>>>>>>>> something,
>>>>>>>> or even treat it as an error and make the script abort.
>>>>>>>>
>>>>>>>> Give it a go and let us know if you need help. For basic (non-bio)
>>>>>>>> Perl
>>>>>>>> question, please also check out the community at
>>>>>>>> http://www.perlmonks.org/.
>>>>>>>>
>>>>>>>> Hope that helps,
>>>>>>>>
>>>>>>>> Frank
>>>>>>>>
>>>>>>>>
>>>>>>>> On 14/01/12 05:59, kakchingtabam pawankumar sharma wrote:
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Hi frank,
>>>>>>>>>
>>>>>>>>> Thanks for your kind reply.
>>>>>>>>> I could get the vale for query as 1 value if it is plus.
>>>>>>>>> and for hit = -1 if it is minus.
>>>>>>>>> But i would like to print out as PLUS or MINUS not 1 or -1 my
>>>>>>>>> friend.
>>>>>>>>>
>>>>>>>>> you can see my code as below:
>>>>>>>>>
>>>>>>>>> while ( my $result = $searchio->next_result() ) {
>>>>>>>>> my $QueryName = $result->query_name(), my $QueryDescript =
>>>>>>>>> $result->query_description();
>>>>>>>>> my $QueryLength = $result->query_length;
>>>>>>>>> my $NoHits = $result->num_hits;
>>>>>>>>>
>>>>>>>>> while( my $hit = $result->next_hit ) {
>>>>>>>>> my $HitName = $hit->name();
>>>>>>>>> my $HitDescrip = $hit->description();
>>>>>>>>> my $HitLength = $hit->length;
>>>>>>>>> my $Score = $hit->raw_score();
>>>>>>>>> my $Bits = $hit->bits;
>>>>>>>>>
>>>>>>>>> my $hsp = $hit->next_hsp; # Only check first (= best) hsp
>>>>>>>>> my $Evalue = $hsp->evalue();
>>>>>>>>> my $AlnLen = $hsp->num_identical();
>>>>>>>>> my $TotalLen = $hsp->hsp_length;
>>>>>>>>> my $QueryStrand = $hsp->strand('query');
>>>>>>>>> my $HitStrand = $hsp->strand('hit');
>>>>>>>>>
>>>>>>>>> if($Evalue< $cutoff){
>>>>>>>>> print "$QueryName $QueryDescript\t";
>>>>>>>>> print "$QueryLength\t";
>>>>>>>>> print "$NoHits\t";
>>>>>>>>> print "$HitName $HitDescrip\t";
>>>>>>>>> print "$HitLength\t";
>>>>>>>>> print "$Score\t";
>>>>>>>>> print "$Bits\t";
>>>>>>>>> print "$Evalue\t";
>>>>>>>>> print "$AlnLen\t";
>>>>>>>>> print "$TotalLen\t";
>>>>>>>>> print "$QueryStrand\t";
>>>>>>>>> print "$HitStrand\n";
>>>>>>>>> }
>>>>>>>>> }
>>>>>>>>> print "\n";
>>>>>>>>> }
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> This is a part of my code.
>>>>>>>>>
>>>>>>>>> i have blastn report as below:
>>>>>>>>>
>>>>>>>>> BLASTN 2.2.18 [Mar-02-2008]
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>>>>> Schaffer,
>>>>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>>>>>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database
>>>>>>>>> search
>>>>>>>>> programs", Nucleic Acids Res. 25:3389-3402.
>>>>>>>>>
>>>>>>>>> Query= ORB_1210001_hsa-miR-548aa#5_1
>>>>>>>>> (24 letters)
>>>>>>>>>
>>>>>>>>> Database: hsa-mmu-rno_miRNA.fa
>>>>>>>>> 3524 sequences; 76,424 total letters
>>>>>>>>>
>>>>>>>>> Searching..................................................done
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Score
>>>>>>>>> E
>>>>>>>>> Sequences producing significant alignments:
>>>>>>>>> (bits)
>>>>>>>>> Value
>>>>>>>>>
>>>>>>>>> hsa-miR-548aa
>>>>>>>>> 48 2e-009
>>>>>>>>> hsa-miR-548d-5p
>>>>>>>>> 36 9e-006
>>>>>>>>> hsa-miR-548b-5p
>>>>>>>>> 36 9e-006
>>>>>>>>> hsa-miR-548z
>>>>>>>>> 34 3e-005
>>>>>>>>> hsa-miR-548q
>>>>>>>>> 30 5e-004
>>>>>>>>> hsa-miR-548n
>>>>>>>>> 30 5e-004
>>>>>>>>> hsa-miR-548ab
>>>>>>>>> 28 0.002
>>>>>>>>> hsa-miR-548v
>>>>>>>>> 28 0.002
>>>>>>>>> hsa-miR-548c-5p
>>>>>>>>> 28 0.002
>>>>>>>>> hsa-miR-548ag
>>>>>>>>> 26 0.008
>>>>>>>>> hsa-miR-548u
>>>>>>>>> 26 0.008
>>>>>>>>> hsa-miR-548c-3p
>>>>>>>>> 26 0.008
>>>>>>>>> hsa-miR-603
>>>>>>>>> 26 0.008
>>>>>>>>> hsa-miR-548a-3p
>>>>>>>>> 26 0.008
>>>>>>>>> hsa-miR-548ac
>>>>>>>>> 24 0.033
>>>>>>>>> hsa-miR-548an
>>>>>>>>> 22 0.13
>>>>>>>>> hsa-miR-548aj
>>>>>>>>> 22 0.13
>>>>>>>>> hsa-miR-548i
>>>>>>>>> 22 0.13
>>>>>>>>> hsa-miR-548g
>>>>>>>>> 22 0.13
>>>>>>>>> hsa-miR-548j
>>>>>>>>> 22 0.13
>>>>>>>>> hsa-miR-548a-5p
>>>>>>>>> 22 0.13
>>>>>>>>>
>>>>>>>>>> hsa-miR-548aa
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Length = 25
>>>>>>>>>
>>>>>>>>> Score = 48.1 bits (24), Expect = 2e-009
>>>>>>>>> Identities = 24/24 (100%)
>>>>>>>>> Strand = Plus / Minus
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Query: 1 tggtgcaaaagtaattgtggtttt 24
>>>>>>>>> ||||||||||||||||||||||||
>>>>>>>>> Sbjct: 25 tggtgcaaaagtaattgtggtttt 2
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>> hsa-miR-548d-5p
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Length = 22
>>>>>>>>>
>>>>>>>>> Score = 36.2 bits (18), Expect = 9e-006
>>>>>>>>> Identities = 18/18 (100%)
>>>>>>>>> Strand = Plus / Plus
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> Query: 7 aaaagtaattgtggtttt 24
>>>>>>>>> ||||||||||||||||||
>>>>>>>>> Sbjct: 1 aaaagtaattgtggtttt 18
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> in this result i could not parse my code. i think my code does not
>>>>>>>>> accept the Query header that is
>>>>>>>>> "ORB_1210001_hsa-miR-548aa#5_1" as it is in the above example blast
>>>>>>>>> output.
>>>>>>>>>
>>>>>>>>> kindly help me out.
>>>>>>>>>
>>>>>>>>> with regards,
>>>>>>>>> Pawan.
>>>>>>>>>
>>>>>>>>>
>>>>>>>>> On Sat, Jan 14, 2012 at 3:13 AM, Frank Schwach<fs5 at sanger.ac.uk>
>>>>>>>>> wrote:
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> Hi Pawan,
>>>>>>>>>>
>>>>>>>>>> Can you show your code? Is it basically following the structure
>>>>>>>>>> shown
>>>>>>>>>> in
>>>>>>>>>> http://www.bioperl.org/wiki/HOWTO:SearchIO#Using_SearchIO
>>>>>>>>>> ?
>>>>>>>>>>
>>>>>>>>>> If that is the case
>>>>>>>>>>
>>>>>>>>>> $hsp->strand('query')
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> is exactly what you need.
>>>>>>>>>> To check if hit and query are on different strands you can do:
>>>>>>>>>>
>>>>>>>>>> if ( $hsp->strand('query')
>>>>>>>>>> * $hsp->strand('hit') == -1){
>>>>>>>>>>
>>>>>>>>>> # do whatever you need to do if they are on opposite strands
>>>>>>>>>>
>>>>>>>>>> }
>>>>>>>>>>
>>>>>>>>>> Hope that helps
>>>>>>>>>>
>>>>>>>>>> Frank
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> On 13/01/12 16:46, kakchingtabam pawankumar sharma wrote:
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Hi,
>>>>>>>>>>> Using Bio::SearchIO module I am parsing the
>>>>>>>>>>> following
>>>>>>>>>>> Blast
>>>>>>>>>>> result.
>>>>>>>>>>> I have used the option- $hsp->strand('query').
>>>>>>>>>>>
>>>>>>>>>>> But I cannot get detail of alignment.
>>>>>>>>>>>
>>>>>>>>>>> I need to know if my hit is forward (Strand = Plus / Plus)
>>>>>>>>>>> or reverse ( Strand = Plus / Minus)...
>>>>>>>>>>> Can anyone help me to get report as Plus or Minus for query or
>>>>>>>>>>> hit.
>>>>>>>>>>>
>>>>>>>>>>> thanks in advanced.
>>>>>>>>>>>
>>>>>>>>>>> With regards,
>>>>>>>>>>> Pawan
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> BLASTN 2.2.18 [Dec-23-2011]
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A.
>>>>>>>>>>> Schaffer,
>>>>>>>>>>> Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman
>>>>>>>>>>> (1997),
>>>>>>>>>>> "Gapped BLAST and PSI-BLAST: a new generation of protein database
>>>>>>>>>>> search
>>>>>>>>>>> programs", Nucleic Acids Res. 25:3389-3402.
>>>>>>>>>>>
>>>>>>>>>>> Query= 000013_c10079-9984
>>>>>>>>>>> (50 letters)
>>>>>>>>>>>
>>>>>>>>>>> Database: Cyano_Probe.fasta
>>>>>>>>>>> 4760 sequences; 238,000 total letters
>>>>>>>>>>>
>>>>>>>>>>> Searching..................................................done
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Score
>>>>>>>>>>> E
>>>>>>>>>>> Sequences producing significant alignments:
>>>>>>>>>>> (bits)
>>>>>>>>>>> Value
>>>>>>>>>>>
>>>>>>>>>>> 000013_c10079-9984
>>>>>>>>>>> 100 7e-024
>>>>>>>>>>> 002619_2689273-2690037
>>>>>>>>>>> 24 0.36
>>>>>>>>>>> 001126_c1123720-1123385
>>>>>>>>>>> 24 0.36
>>>>>>>>>>> 003211_c3326737-3326480
>>>>>>>>>>> 22 1.4
>>>>>>>>>>> 002415_2471082-2471420
>>>>>>>>>>> 22 1.4
>>>>>>>>>>> 002269_2321276-2322463
>>>>>>>>>>> 22 1.4
>>>>>>>>>>> 001328_c1326535-1326164
>>>>>>>>>>> 22 1.4
>>>>>>>>>>>
>>>>>>>>>>>> 000013_c10079-9984
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Length = 50
>>>>>>>>>>>
>>>>>>>>>>> Score = 99.6 bits (50), Expect = 7e-024
>>>>>>>>>>> Identities = 50/50 (100%)
>>>>>>>>>>> Strand = Plus / Plus
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>> Query: 1 agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>>>>>>>> ||||||||||||||||||||||||||||||||||||||||||||||||||
>>>>>>>>>>> Sbjct: 1 agtcaacaccaatctgagtttaatcactatcttgatcatgttagatatca 50
>>>>>>>>>>>
>>>>>>>>>>> _______________________________________________
>>>>>>>>>>> Bioperl-l mailing list
>>>>>>>>>>> Bioperl-l at lists.open-bio.org
>>>>>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> --
>>>>>>>>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>>>>>>>>> Limited,
>>>>>>>>>> a charity registered in England with number 1021457 and a company
>>>>>>>>>> registered
>>>>>>>>>> in England with number 2742969, whose registered office is 215
>>>>>>>>>> Euston
>>>>>>>>>> Road,
>>>>>>>>>> London, NW1 2BE.
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> --
>>>>>>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>>>>>>> Limited, a charity registered in England with number 1021457 and a
>>>>>>>> company registered in England with number 2742969, whose registered
>>>>>>>> office is 215 Euston Road, London, NW1 2BE.
>>>>>>>>
>>>>>>
>>>>>>
>>>>>> --
>>>>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>>>>> Limited,
>>>>>> a charity registered in England with number 1021457 and a company
>>>>>> registered
>>>>>> in England with number 2742969, whose registered office is 215 Euston
>>>>>> Road,
>>>>>> London, NW1 2BE.
>>>>
>>>>
>>>>
>>>> --
>>>> The Wellcome Trust Sanger Institute is operated by Genome Research
>>>> Limited,
>>>> a charity registered in England with number 1021457 and a company
>>>> registered
>>>> in England with number 2742969, whose registered office is 215 Euston
>>>> Road,
>>>> London, NW1 2BE.
>>
>>
>> --
>> The Wellcome Trust Sanger Institute is operated by Genome Research
>> Limited, a charity registered in England with number 1021457 and a
>> company registered in England with number 2742969, whose registered
>> office is 215 Euston Road, London, NW1 2BE.
>>
--
The Wellcome Trust Sanger Institute is operated by Genome Research
Limited, a charity registered in England with number 1021457 and a
company registered in England with number 2742969, whose registered
office is 215 Euston Road, London, NW1 2BE.
More information about the Bioperl-l
mailing list