[Bioperl-l] UTR regions in LiveSeq

[Jason Stajich]

To answer your simply, no, there is no plan to add this capability unless someone jumps in and wants to code it.  
This is a volunteer project and the person working on those modules stopped ~8 years ago after they were developed for their needs.  

There are other toolkits that do implement aspects that calculate the effects of mutations but would be nice to have something that worked within the code base here.

I would encourage you to look into writing the modules you need if you have a need to do this. This is a collaborative project where people hopefully work to develop new code that they need and do it in collaboration with other developers to make the job easier and we are happy to help improve code that someone starts and contributes to the toolkit.
 
-Jason
On Jun 23, 2011, at 5:20 AM, htafer wrote:

> Hi
> I am currently working on SNPs and would like to use BioPerl.
> I am using LiveSeq objects to store the sequence and I am looking at
> mutations by using the Mutation/Mutator objects.
> 
> More explicitly:
> Given a set of annotation I extract the boundaries for all exons/
> introns, the boundaries for the transcript as well as for the coding
> sequence. Based on these boundaries and the corresponding genomic
> sequence I construct the Bio::LiveSeq::{ DNA/Exon/Transcript/
> Translation } objects which allow me to construct a Bio::LiveSeq::Gene
> object.
> 
> Then based on a list of SNPs, I generate a set of
> Bio::LiveSeq::mutation objects and a Bio::LiveSeq::mutator
> which I then used mutate my gene. My main problem here is that I dont
> know how to handle transcripts having UTR, or ncRNAs, i.e transcripts/
> exons that do not code for protein. According to the documentation of
> Bio::LiveSeq::Transcript, this class is aimed at storing information
> about coding sequences (CDS) only.
> 
> The following code for transcripts with UTR is somewhat working,
> delivering the expected results. Still the alignment function of
> Bio::LiveSeq::Mutator do not work. So is there some plan to introduce
> Bio::LiveSeq::UTR similar to Bio::SeqFeature::Gene::UTR and to better
> suppot ncRNA/UTR with the mutator object? Or is it possible to do this
> with current BioPerl implementation?
> 
> my $DNAsequence = Bio::LiveSeq::DNA->new( -seq =>
> "GGGGGGGGGGATGAAAAAAATTTTTTTTTTAAAAAAAATAGCCCCCCCCCC");
> 
> 
> 
> my $utr5 = Bio::LiveSeq::Exon-> new(-seq => $DNAsequence,
>                                    -start => 1,
>                                    -end => 10,
>                                    -strand => 1);
> my $exon1 = Bio::LiveSeq::Exon-> new(-seq => $DNAsequence,
>                                     -start => 11,
>                                     -end => 20,
>                                     -strand => 1);
> my $intron1 =Bio::LiveSeq::Intron-> new(-seq => $DNAsequence,
>                                     -start => 21,
>                                     -end => 30,
>                                     -strand => 1);
> 
> my $exon2 = Bio::LiveSeq::Exon-> new(-seq => $DNAsequence,
>                                     -start => 31,
>                                     -end => 41,
>                                     -strand => 1);
> my $utr3 = Bio::LiveSeq::Exon-> new(-seq => $DNAsequence,
>                                    -start => 42,
>                                    -end => 51,
>                                    -strand => 1);
> 
> my @tarray = ($exon1, $exon2);
> my @uarray = ($utr5, $exon1, $exon2,$utr3);
> my @iarray = ($intron1);
> my $Transcript = Bio::LiveSeq::Transcript->new( -exons => \@uarray);
> my $translationTranscript = Bio::LiveSeq::Transcript->new( -exons =>
> \@tarray);
> my $Translation= Bio::LiveSeq::Translation->new( -transcript =>
> $translationTranscript);
> #need to do this to avoid change_error()
> $Transcript->{'translation'}=$Translation;
> my $features;
> $features->{DNA} = $DNAsequence;
> $features->{Transcripts} = [$Transcript];
> $features->{Translations} = [$Translation];
> $features->{Exons} = \@uarray;
> $features->{Introns} = \@iarray;
> 
> 
> my $gene=Bio::LiveSeq::Gene->new(-name => "bla",
>                                 -features => $features);
> 
> my $mutation = new Bio::LiveSeq::Mutation (-seq =>'',
>                                           -pos => 32,
>                                           -len => 3
>                                          );
> 
> my $mutate = Bio::LiveSeq::Mutator->new(-gene => $gene,
>                                        -numbering => 'entry'
>                                       );
> 
> $mutate->add_Mutation($mutation);
> 
> dna_mut:GGGGGGGGGGATGAAAAAAATTTTTTTTTTAAAAATAGCCCCCCCCCC
> dna_ori:  GGGGGGGGGGATGAAAAAAATTTTTTTTTTAAAAAAAATAGCCCCCCCCCC
> rna_mut: GGGGGGGGGGATGAAAAAAAAAAAATAGCCCCCCCCCC
> rna_ori:  GGGGGGGGGGATGAAAAAAAAAAAAAAATAGCCCCCCCCCC
> aa_mut: MKKKK*
> aa_ori:   MKKKKK*
> 
> print $results->alignment();
> Variant  :     GAT GAA AAA AAA     AAA ATA GCC CCC
> Reference:     GAT GAA AAA AAA Bio AAA ATA GCC CCC
>                    E   K   K   X   K   I   A
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l