[Bioperl-l] problem with Bio::Align::Utilities - aa_to_dna_aln

[Sofia]

Hi,

I'm using the aa_to_dna_aln function from the BioPerl module 
Bio::Align::Utilities.

I've used it some time ago and now i'm just re-running an old script and 
i get this error repeatedly:

substr outside of string at 
/common/software/API/bioperl-1.6.1/lib/perl5/site_perl/5.8.8//Bio/Align/Utilities.pm 
line 160.
Use of uninitialized value in string eq at 
/common/software/API/bioperl-1.6.1/lib/perl5/site_perl/5.8.8//Bio/Align/Utilities.pm 
line 161.

--------------------- WARNING ---------------------
MSG: In sequence ENSP00000372224 residue count gives end value 1161.
Overriding value [1107] with value 1161 for Bio::LocatableSeq::end().
ATGGGGCGCTGGGCCTGGGTCCCCAGCCCCTGGCCCCCACCGGGGCTGGGCCCCTTCCTCCTCCTCCTCCTGCTGCTGCTGCTGCTGCCACGGGGGTTCCAGCCCCAGCCTGGCGGGAACCGTACGGAGTCCCCAGAACCTAATGCCACAGCGACCCCTGCGATCCCCACTATCCTGGTGACCTCTGTGACCTCTGAGACCCCAGCAACAAGTGCTCCAGAGGCAGAGGGACCCCAAAGTGGGGGGCTCCCGCCCCCGCCCAGGGCAGTTCCCTCGAGCAGTAGCCCCCAGGCCCAAGCACTCACCGAGGAC
---------------------------------------------------

I had a look at the code of Utilities.pm and the line 160 is:

my $char = substr($aa_seqstr,$i + $start_offset,1);

I was wondering why is the $start_offset applied to the amino acid 
sequence $aa_seqstr and not to the dna sequence $nt_seqstr(line 164)?

When i remove the $start_offset from the line 160 and add it to the line 
164 i don't get any errors.

I don't know if that is a problem or if the problem are the arguments 
sending to the function.

The arguments i'm using are the same i used before: an alignment of 
protein sequences and a set of dna sequences. Did something change 
regarding the arguments?

I would appreciate any help you could provide.

Best regards,
Sofia Pinto