[Bioperl-l] Problem with ka/ks ratio
subarna thakur
bubli_thakur at rediffmail.com
Tue Apr 12 12:07:12 UTC 2011
Hi all,I running the following perl script for generating the ka/ks ratio using PAML-
----------------------------------------------------------------#!perl -w
use strict;
BEGIN { $ENV{CLUSTALDIR} = '/usr/local/bin' }
BEGIN { $ENV{PAMLDIR} = '/root/Desktop/paml44/bin' }
# $Id: pairwise_kaks.PLS 15088 2008-12-04 02:49:09Z bosborne $
# Author Jason Stajich <jason-at-bioperl-dot-org>
=head1 NAME
pairwise_kaks - script to calculate pairwise Ka,Ks for a set of sequences
=head1 SYNOPSIS
pairwise_kaks.PLS -i t/data/worm_fam_2785.cdna [-f fasta/genbank/embl...] [-msa tcoffee/clustal] [-kaks yn00/codeml]
=head1 DESCRIPTION
This script will take as input a dataset of cDNA sequences verify
that they contain no stop codons, align them in protein space,
project the alignment back into cDNA and estimate the Ka
(non-synonymous) and Ks (synonymous) substitutions based on the ML
method of Yang with the PAML package.
Requires:
* bioperl-run package
* PAML program codeml or yn00
* Multiple sequence alignment programs Clustalw OR T-Coffee
Often there are specific specific parameters you want to run when you
a computing Ka/Ks ratios so consider this script a starting point and
do not rely it on for every situation.
=head1 FEEDBACK
=head2 Mailing Lists
User feedback is an integral part of the evolution of this and other
Bioperl modules. Send your comments and suggestions preferably to
the Bioperl mailing list. Your participation is much appreciated.
bioperl-l at bioperl.org - General discussion
http://bioperl.org/wiki/Mailing_lists - About the mailing lists
=head2 Reporting Bugs
Report bugs to the Bioperl bug tracking system to help us keep track
of the bugs and their resolution. Bug reports can be submitted via the
web:
http://bugzilla.open-bio.org/
=head1 AUTHOR
Jason Stajich jason-at-bioperl-dot-org
=cut
eval {
# Ka/Ks estimators
require Bio::Tools::Run::Phylo::PAML::Codeml;
require Bio::Tools::Run::Phylo::PAML::Yn00;
# Multiple Sequence Alignment programs
require Bio::Tools::Run::Alignment::Clustalw;
require Bio::Tools::Run::Alignment::TCoffee;
};
if( $@ ) {
die("Must have bioperl-run pkg installed to run this script");
}
# for projecting alignments from protein to R/DNA space
use Bio::Align::Utilities qw(aa_to_dna_aln);
# for input of the sequence data
use Bio::SeqIO;
use Bio::AlignIO;
# for the command line argument parsing
use Getopt::Long;
my ($aln_prog, $kaks_prog,$format, $output,
$cdna,$verbose,$help) = qw(clustalw codeml fasta);
GetOptions(
'i|input:s' => \$cdna,
'o|output:s' => \$output,
'f|format:s' => \$format,
'msa:s' => \$aln_prog,
'kaks:s' => \$kaks_prog,
'v|verbose' => \$verbose,
'h|help' => \$help,
);
if( $help ) {
exec('perldoc',$0);
exit(0);
}
$verbose = -1 unless $verbose;
my ($aln_factory,$kaks_factory);
if( $aln_prog =~ /clus/i ) {
$aln_factory = Bio::Tools::Run::Alignment::Clustalw->new(-verbose => $verbose);
} elsif( $aln_prog =~ /t\_?cof/i ) {
$aln_factory = Bio::Tools::Run::Alignment::TCoffee->new(-verbose => $verbose);
} else {
warn("Did not provide either 'clustalw' or 'tcoffee' as alignment program names");
exit(0);
}
unless( $aln_factory->executable ) {
warn("Could not find the executable for $aln_prog, make sure you have installed it and have either set ".uc($aln_prog)."DIR or it is in your PATH");
exit(0);
}
if( $kaks_prog =~ /yn00/i ) {
$kaks_factory = Bio::Tools::Run::Phylo::PAML::Yn00->new(-verbose => $verbose);
} elsif( $kaks_prog =~ /codeml/i ) {
# change the parameters here if you want to tweak your Codeml running!
$kaks_factory = Bio::Tools::Run::Phylo::PAML::Codeml->new
(-verbose => $verbose,
-params => { 'runmode' => -2,
'seqtype' => 1,
}
);
}
unless ( $kaks_factory->executable ) {
warn("Could not find the executable for $kaks_prog, make sure you have installed it and you have defined PAMLDIR or it is in your PATH");
exit(0);
}
unless ( $cdna && -f $cdna && -r $cdna && ! -z $cdna ) {
warn("Did not specify a valid cDNA sequence file as input");
exit(0);
}
my $seqin = new Bio::SeqIO(-file => $cdna,
-format => $format);
my %seqs;
my @prots;
while( my $seq = $seqin->next_seq ) {
$seqs{$seq->display_id} = $seq;
my $protein = $seq->translate();
my $pseq = $protein->seq();
$pseq =~ s/\*$//;
if( $pseq =~ /\*/ ) {
warn("provided a cDNA (".$seq->display_id.") sequence with a stop codon, PAML will choke!");
exit(0);
}
# Tcoffee can't handle '*'
$pseq =~ s/\*//g;
$protein->seq($pseq);
push @prots, $protein;
}
if( @prots < 2 ) {
warn("Need at least 2 cDNA sequences to proceed");
exit(0);
}
local * OUT;
if( $output ) {
open(OUT, ">$output") || die("cannot open output $output for writing");
} else {
*OUT = *STDOUT;
}
my $aa_aln = $aln_factory->align(\@prots);
my $dna_aln = &aa_to_dna_aln($aa_aln, \%seqs);
my @each = $dna_aln->each_seq();
$kaks_factory->alignment($dna_aln);
my ($rc,$parser) = $kaks_factory->run();
if( $rc <= 0 ) {
warn($kaks_factory->error_string,"\n");
exit;
}
my $result = $parser->next_result;
if ($result->version =~ m/3\.15/) {
warn("This script does not work with v3.15 of PAML! Please use 3.14 instead.");
exit(0);
}
my $MLmatrix = $result->get_MLmatrix();
my @otus = $result->get_seqs();
my @pos = map {
my $c= 1;
foreach my $s ( @each ) {
last if( $s->display_id eq $_->display_id );
$c++;
}
$c;
} @otus;
print OUT join("\t", qw(SEQ1 SEQ2 Ka Ks Ka/Ks PROT_PERCENTID CDNA_PERCENTID)), "\n";
for( my $i = 0; $i < (scalar @otus -1) ; $i++) {
for( my $j = $i+1; $j < (scalar @otus); $j++ ) {
my $sub_aa_aln = $aa_aln->select_noncont($pos[$i],$pos[$j]);
my $sub_dna_aln = $dna_aln->select_noncont($pos[$i],$pos[$j]);
print OUT join("\t",
$otus[$i]->display_id,
$otus[$j]->display_id,$MLmatrix->[$i]->[$j]->{'dN'},
$MLmatrix->[$i]->[$j]->{'dS'},
$MLmatrix->[$i]->[$j]->{'omega'},
sprintf("%.2f",$sub_aa_aln->percentage_identity),
sprintf("%.2f",$sub_dna_aln->percentage_identity),
), "\n";
}
}-----------------------------------------------------------------After running the code on the following fasta file >seq1
TCTCTCTGGCCCAAAATCCGGGTTCCATTAAAAGTTGTGAGGACTGCTGAAAACAAGTTA
AGTAACCGTTTCTTCCCTTATGATGAAATCGAGACAGAAGCTGTTCTGGCCATTGATGAT
GATATCATTATGCTGACCTCTGACGAGCTGCAATTTGGTTATGAG
>seq2
TCACTGTGGCCCAAAGTCGCAGTGCCTCTTAAAGTGGTCCGCACCAAAGAAAACAAGCTC
AGCAATCGATTCTTTCCGTTTGATGAGATCGAGACAGAAGCTGTCCTGGCCATTGACGAT
GACATCATCATGTTAACCTCAGATGAGCTACAGTTTGGATATGAG---------------------------------------------I am getting the result as-SEQ1 SEQ2 Ka Ks Ka/Ks PROT_PERCENTID CDNA_PERCENTIDBut no values are coming .Can Anybody help me to figureout the problemThanksSubarna
More information about the Bioperl-l
mailing list