[Bioperl-l] blast results: how to get forward/reverse strand info?

[fpf at biochem.mpg.de]

Dear BioPerl specialists,

At the end is part of a blast result which I want to parse:

Blast version: BLASTN 2.2.24 [Aug-08-2010]

BioPerl call:
use Bio::SearchIO ;
...
   my $stringfh = new IO::String ($blaststring);
   my $in = new Bio::SearchIO (-format => 'blast', -fh => $stringfh)
         or die "parsing blast output string failed";

I need to know if my hit is forward (Strand = Plus / Plus)
or reverse ( Strand = Plus / Minus)

As I did not see how this information is returned, I checked if
hit_end is > or < hit_start. However, the hit_start and hit_end coordinates
are given "(in original hit sequence coords)" as stated in e.g.
http://search.cpan.org/~cjfields/BioPerl-1.6.1/Bio/Search/HSP/GenericHSP.pm

In the example below,
hit_start is 24885
hit_end is 25902

How to find out if the hit is to the forward or reverse strand?
I tried "->strand" but without success (always returns 1)

Thanks for your help

Friedhelm Pfeiffer
fpf at biochem.mpg.de


here is blaststring (central alignment section removed)

> Hfvol_pHV3 haloVolc1_dna pHV3
           Length = 437906

  Score = 1905 bits (961), Expect = 0.0
  Identities = 1009/1021 (98%), Gaps = 3/1021 (0%)
  Strand = Plus / Minus

Query: 27    cggcgatgccgaggatttcggaccgccggacgcgcagggaaacgccgtcgacggcgcgga 86
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 25902  
cggcgatgccgaggatttcggaccgccggacgcgcagggaaacgccgtcgacggcgcgga 25843

...

Query: 986   tcaggtcccgggccctggaattcgatgctggccggattcaacggaacctttgctggggag 1045
              ||||||||| ||||||||||||||||||| ||||||||| ||||| || |||||||||||
Sbjct: 24942  
tcaggtccc-ggccctggaattcgatgct-gccggattcgacggagccgttgctggggag 24885