[Bioperl-l] SearchIO: Features in/flanking this part of a subject sequence

[Chris Fields]

I'm assuming this is from an older bioperl; this data should be  
accessible via $hsp->hit_features in the latest code fromo svn (and I  
believe in bioperl 1.6.0 in CPAN).

chris

On Apr 29, 2009, at 2:08 PM, Razi Khaja wrote:

> Hello,
>
> I am generating BLAST alignments using the BLAST URL API from NCBI.
>
> I want to parse details from BLAST reports whenever there are
> "Features in/flanking this part of subject sequence".  A portion of
> the BLAST report showing "Features flanking ..." is pasted below.
>
> I am using Bio::SearchIO to parse details.  The relevant part of the
> script is below.
>
> The problem I am having is that for some reason the first occurrence
> of a "Feature flanking this part of a subject sequence" is skipped.
> I am only able to parse/print all occurrences of a "Feature
> in/flanking this part of a subject sequence" from the second
> occurrence to the last occurrence.
>
> I believe the code responsible for parsing this information is in
> Bio/SearchIO/blast.pm, starting on line 760.
> I have tried fixing the code in Bio/SearchIO/blast.pm myself but was
> not able to correct the problem.
> Would it be possible for someone to fix the code in the
> Bio/SearchIO/blast.pm module, or help me fix the code so that the
> first occurrence is not skipped?
>
> Thanks,
> Razi



> ===== The part of the script that is relevant to parsing "Features
> in/flanking..." ====
> my $bio_searchio_in = Bio::SearchIO->new(
>     -file   => 'blast_result.txt',
>     -format => 'blast'
> );
>
> my $i = 1;
> while( my $result = $bio_searchio_in->next_result() ){
>     while( my $hit = $result->next_hit() ){
>         while( my $hsp = $hit->next_hsp() ){
>             my $hsp_features = $hsp->hit_features();
>             if( $hsp_features ) {
>                 print "HSP FEATURE $i\t$hsp_features\n";
>                 $i++;
>             }
>         }
>     }
> }
>
> ===== A portion of a BLAST report with "Features flanking ..." =====
> ...
> ...
>  Score = 54.7 bits (29),  Expect = 0.003
>  Identities = 29/29 (100%), Gaps = 0/29 (0%)
>  Strand=Plus/Minus
>
> Query  6556     CCTGGGTGACAGAGTGAGACTCCATCTCA  6584
>                 |||||||||||||||||||||||||||||
> Sbjct  6953042  CCTGGGTGACAGAGTGAGACTCCATCTCA  6953014
>
>
>> gi|51459264|ref|NT_077382.3|Hs1_77431 Homo sapiens chromosome 1  
>> genomic contig
> Length=237250
>
>  Features flanking this part of subject sequence:
>    16338 bp at 5' side: PRAME family member 8
>    11926 bp at 3' side: PRAME family member 9
>
>  Score = 7286 bits (3945),  Expect = 0.0
>  Identities = 5437/6145 (88%), Gaps = 152/6145 (2%)
>  Strand=Plus/Plus
>
> Query  23225   
> GGTTGGTTAATATTGATAATTAAATGACTTGGTACTGAGAAGAAGCTATAGGTGCAAATG
> 23284
>               |||||||||||||||||||||||||||||||| |||||| |||||||||||  
> ||||||||
> Sbjct  86128   
> GGTTGGTTAATATTGATAATTAAATGACTTGGCACTGAGCAGAAGCTATAGATGCAAATG
> 86187
>
> Query  23285   
> GGTGGCCTATGACTATTATTGATTTCATTACTGGTAATTTATCTCTATGCCTAGAAAACA
> 23344
>               ||||||||||||||||| |||||||||||||| |||| ||||||| |||| |||  
> |||||
> Sbjct  86188   
> GGTGGCCTATGACTATTGTTGATTTCATTACTTGTAACTTATCTCCATGCATAGGAAACA
> 86247
> ...
> ...
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l