[Bioperl-l] run RNAfold in perl
Chris Fields
cjfields at uiuc.edu
Sun Nov 25 15:05:27 UTC 2007
Again, these wrappers are for submitting data to a Pise server for
the corresponding programs (run on a remote server). There are no
wrappers for running RNAfold on your computer (i.e. locally), with or
w/o a set env. variable. You can try instaling Pise locally and
setting the location() as shown in POD to localhost, however I don't
know how stable these modules are with newer versions of Pise. These
haven't been updated in a few years, apart from getting tests to work.
Another option is installing EMBOSS along with the EMBASSY version of
RNAFold; this could conceivably be run through Bio::Factory::EMBOSS.
chris
On Nov 24, 2007, at 1:29 AM, vanam wrote:
>
> i have seen the documentation for
> Bio::Tools::Run::AnalysisFactory::Pise and
> i used it exactly as it was mentioned in it.
>
> i just want that instead of running its perl version "RNAfold.pl" I
> can use
> the functions associated with RNAfold with a perl program without
> having to
> call the program using system() command.
>
> if you can just tell me how to use these wrapper modules it would b
> of gr8
> help...like while using clustalw or clustalx we define the environment
> variable for it ..do we have to do the same for RNAfold or Mfold
>
>
>
>
> Chris Fields wrote:
>>
>> The Pise wrappers run the programs remotely; see
>> Bio::Tools::Run::AnalysisFactory::Pise on how to run it. As for a
>> local RNAfold wrapper, I had planned on making Bioperl-based Vienna/
>> mfold wrappers but haven't done so yet. The Vienna tools do have a
>> Perl-based (non-BioPerl-based) module included which uses libRNA, and
>> is well worth a look. Try 'perldoc RNA' if you have installed the
>> tools locally, or look here for other Perl-based tools:
>>
>> http://www.tbi.univie.ac.at/~ivo/RNA/utils.html
>>
>> chris
>>
>> On Nov 23, 2007, at 3:26 PM, vanam wrote:
>>
>>>
>>> how to run RNAfold using Bio::Tools::Run::AnalysisFactory::Pise?????
>>>
>>> my $factory = Bio::Tools::Run::AnalysisFactory::Pise->new();
>>> my $rnafold = $factory->program('rnafold');
>>> my $job=$rnafold->run(-rnafold =>
>>> 'UUUGACGACAGACGACUCAAUGUCAGCUAGCUAGUACGAUCGAUC');
>>>
>>> I installed Vienna package and then i tried using Pise to create an
>>> object
>>> for the program but its giving the following error
>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>> MSG: Bio::Tools::Run::PiseJob terminated: URL missing
>>> STACK: Error::throw
>>> STACK: Bio::Root::Root::throw
>>> /usr/local/share/perl/5.8.8/Bio/Root/Root.pm:359
>>> STACK: Bio::Tools::Run::PiseJob::terminated
>>> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseJob.pm:460
>>> STACK: Bio::Tools::Run::PiseApplication::submit
>>> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseApplication.pm:416
>>> STACK: Bio::Tools::Run::PiseApplication::run
>>> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseApplication.pm:352
>>> STACK: evaluate.pl:12
>>>
>>>
>>> how to make the program RNAfold run in perl...
>>> IS THERE ANY NEED TO SPECIFY WHERE MY rnafold program is???
>>>
>>> plz reply soon
>>> --
>>> View this message in context: http://www.nabble.com/run-RNAfold-in-
>>> perl-tf4863835.html#a13918981
>>> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>>>
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>> Christopher Fields
>> Postdoctoral Researcher
>> Lab of Dr. Robert Switzer
>> Dept of Biochemistry
>> University of Illinois Urbana-Champaign
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>
> --
> View this message in context: http://www.nabble.com/run-RNAfold-in-
> perl-tf4863835.html#a13922740
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign
More information about the Bioperl-l
mailing list