[Bioperl-l] run RNAfold in perl

[Chris Fields]

The Pise wrappers run the programs remotely; see  
Bio::Tools::Run::AnalysisFactory::Pise on how to run it.  As for a  
local RNAfold wrapper, I had planned on making Bioperl-based Vienna/ 
mfold wrappers but haven't done so yet.  The Vienna tools do have a  
Perl-based (non-BioPerl-based) module included which uses libRNA, and  
is well worth a look.  Try 'perldoc RNA' if you have installed the  
tools locally, or look here for other Perl-based tools:

http://www.tbi.univie.ac.at/~ivo/RNA/utils.html

chris

On Nov 23, 2007, at 3:26 PM, vanam wrote:

>
> how to run RNAfold using Bio::Tools::Run::AnalysisFactory::Pise?????
>
> my $factory = Bio::Tools::Run::AnalysisFactory::Pise->new();
> my $rnafold = $factory->program('rnafold');
> my $job=$rnafold->run(-rnafold =>
> 'UUUGACGACAGACGACUCAAUGUCAGCUAGCUAGUACGAUCGAUC');
>
> I installed Vienna package and then i tried using Pise to create an  
> object
> for the program but its giving the following error
> ------------- EXCEPTION: Bio::Root::Exception -------------
> MSG: Bio::Tools::Run::PiseJob terminated: URL missing
> STACK: Error::throw
> STACK: Bio::Root::Root::throw
> /usr/local/share/perl/5.8.8/Bio/Root/Root.pm:359
> STACK: Bio::Tools::Run::PiseJob::terminated
> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseJob.pm:460
> STACK: Bio::Tools::Run::PiseApplication::submit
> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseApplication.pm:416
> STACK: Bio::Tools::Run::PiseApplication::run
> /usr/local/share/perl/5.8.8/Bio/Tools/Run/PiseApplication.pm:352
> STACK: evaluate.pl:12
>
>
> how to make the program RNAfold run in perl...
> IS THERE ANY NEED TO SPECIFY WHERE MY rnafold program is???
>
> plz reply soon
> -- 
> View this message in context: http://www.nabble.com/run-RNAfold-in- 
> perl-tf4863835.html#a13918981
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l

Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign