[Bioperl-l] no revcom method in Bio::Seq module?

[Christopher Fields]

I think the confusion lies in what revcom returns.  This page

http://www.bioperl.org/wiki/Getting_Started

show a quick way of using revcom, (which I mentioned previously) while this 
page

http://www.bioperl.org/wiki/HOWTO:Beginners

explains what is returned when you use revcom.  '$seq_obj->revcom' returns a 
sequence object (not a sequence string):

http://www.bioperl.org/wiki/HOWTO:Beginners#The_Sequence_Object

which is why you need to use the 'seq' method to get the string.

Hence, '$seq_obj->revcom->seq'.

Chris

---- Original message ----
>Date: Sun, 14 May 2006 11:08:49 -0700 (PDT)
>From: chen li <chen_li3 at yahoo.com>  
>Subject: RE: [Bioperl-l] no revcom method in Bio::Seq module?  
>To: Chris Fields <cjfields at uiuc.edu>
>Cc: bioperl-l at bioperl.org
>
>Hi Chris,
>
>Thank you very much. But could you please give me the
>link for this syntax: $seq->revcom->seq?
>
>Li
>
>
>
>--- Chris Fields <cjfields at uiuc.edu> wrote:
>
>> This line should give you the hint:
>> 
>> 	#revcom=Bio::Seq=HASH(0x10493304)
>> 
>> You're getting an object ref here.  The actual way
>> to get the rev. comp on
>> the wiki states '$seq->revcom->seq', not
>> '$seq->revcom'.
>> 
>> When I ran your script and change your line to the
>> wiki version I get (using
>> my test seq):
>> 
>> what attributes/keys are available:
>> primary_id      =>      test,
>> primary_seq     =>     
>> Bio::PrimarySeq=HASH(0x1d47fe0)
>> primary_id=test,
>> 
>> id=test,
>> 
>>
>revcom=GGAACGAGATCTCCATGCCGCGCACCATCGGCCCGGGATGCAGCACGAT
CGCGCGGTCCGGCAGCATCG
>> CCTGGCGCTTCTCGGACAATCCGTAGCGCACCGAGTACTCACGCGCGGA
>>
>CGGGAAGAAACTGCCGTTCATGCGTTCGGCCTGCACGCGCAGCATGAGCACCGCG
TCGGCCGCGGGCAGTTCGGCG
>> TCCAGGTCATAGGACACGGTCACCGGCCAGTTCTCGACGCCCCTGGGGA
>>
>GCAGCGTCGGTGGGGACACCAGCACCACCTCGGCCCCGAGGGTGTGCAGCAGCGT
CACGTTGGAGCGGGCCACGCG
>> GCTGTGCAGCACGTCGCCGACGATCACCACGCGCTTGCCCTCGACGCTG
>> 
>> Sun May 14 17:34:45 2006
>> 
>> Chris
>> 
>> > -----Original Message-----
>> > From: bioperl-l-bounces at lists.open-bio.org
>> [mailto:bioperl-l-
>> > bounces at lists.open-bio.org] On Behalf Of chen li
>> > Sent: Sunday, May 14, 2006 12:15 PM
>> > To: bioperl-l at bioperl.org
>> > Subject: [Bioperl-l] no revcom method in Bio::Seq
>> module?
>> > 
>> > Hi all,
>> > 
>> > I need to get a reverse-complemenary sequence out
>> of a
>> > fasta sequence file. And the Synopsis of Bio::Seq
>> > points out I can do like this way:
>> > 
>> > $revcom=$seqobj->revcom();
>> > 
>> > I use the following script trying to get the job
>> done
>> > but it doesn't work. Then I read documentation of
>> > Bio::Seq and it looks like it doesn't contain
>> revcom
>> > method.
>> > 
>> > Any idea will be appreciated.
>> > 
>> > Li
>> > 
>> > 
>> > ###############################
>> > Here is the code:
>> > 
>> > #!c:/perl/bin/perl.exe
>> > use strict;
>> > use warnings;
>> > 
>> > use Bio::Seq;
>> > use Bio::SeqIO;
>> > 
>> > my
>> $file='c:/perl/local/primer3_1.0.0/src/est.txt';
>> > 
>> > 
>> > my $seqIO=Bio::SeqIO->new(-file=>"<$file",
>> >                             -format=>'fasta' );
>> > 
>> >     my $seqobj=$seqIO->next_seq();#create object
>> > 
>> >   print "what attributes/keys are available:\n";
>> >   for my $key (sort keys %$seqobj){
>> >            my $value=$seqobj->{$key};
>> > 	    print "$key\t=>\t$value\n"
>> > 	    }
>> > # These are the output on the screen
>> > #primary_id =>      gi|54093|emb|X61809.1|
>> > #primary_seq =>    
>> Bio::PrimarySeq=HASH(0x10492848)
>> > 
>> > #based on these results primary_id can get
>> > #access right away
>> > # as to primary_seq it is an object in
>> > #Bio::Primaryseq and it provides the following
>> > #methods after reading the documentaion:
>> >                 #new
>> > 		#seq
>> > 		#validate_seq
>> > 		#subseq
>> > 		#length
>> > 		#display_id
>> > 		#accession_number
>> > 		#primary_id
>> > 		#alphabet
>> > 		#desc
>> > 		#can_call_new
>> > 		#id
>> > 		#is_circular
>> > 		#object_id
>> > 		#version
>> > 		#authority
>> > 		#namespace
>> > 		#display_name
>> > 		#description
>> > 
>> > print "primary_id=",$seqobj->primary_id, "\n\n";
>> > print "id=",$seqobj->id, "\n\n";
>> > print "revcom=",$seqobj->revcom,"\n\n";
>> > 
>> >         my $now_time=localtime;
>> >         print  $now_time, "\n\n";
>> >         exit;
>> > 
>> >  #These are the output on the screen
>> > 	#primary_id=gi|54093|emb|X61809.1|
>> > 	#id=gi|54093|emb|X61809.1
>> > 	#revcom=Bio::Seq=HASH(0x10493304)
>> > 	#Sun May 14 12:45:20 2006
>> > 
>> > 
>> > 
>> > __________________________________________________
>> > Do You Yahoo!?
>> > Tired of spam?  Yahoo! Mail has the best spam
>> protection around
>> > http://mail.yahoo.com
>> > _______________________________________________
>> > Bioperl-l mailing list
>> > Bioperl-l at lists.open-bio.org
>> >
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>> 
>> 
>
>
>__________________________________________________
>Do You Yahoo!?
>Tired of spam?  Yahoo! Mail has the best spam protection around 
>http://mail.yahoo.com