[Bioperl-l] no revcom method in Bio::Seq module?

[chen li]

Hi Chris,

Thank you very much. But could you please give me the
link for this syntax: $seq->revcom->seq?

Li



--- Chris Fields <cjfields at uiuc.edu> wrote:

> This line should give you the hint:
> 
> 	#revcom=Bio::Seq=HASH(0x10493304)
> 
> You're getting an object ref here.  The actual way
> to get the rev. comp on
> the wiki states '$seq->revcom->seq', not
> '$seq->revcom'.
> 
> When I ran your script and change your line to the
> wiki version I get (using
> my test seq):
> 
> what attributes/keys are available:
> primary_id      =>      test,
> primary_seq     =>     
> Bio::PrimarySeq=HASH(0x1d47fe0)
> primary_id=test,
> 
> id=test,
> 
>
revcom=GGAACGAGATCTCCATGCCGCGCACCATCGGCCCGGGATGCAGCACGATCGCGCGGTCCGGCAGCATCG
> CCTGGCGCTTCTCGGACAATCCGTAGCGCACCGAGTACTCACGCGCGGA
>
CGGGAAGAAACTGCCGTTCATGCGTTCGGCCTGCACGCGCAGCATGAGCACCGCGTCGGCCGCGGGCAGTTCGGCG
> TCCAGGTCATAGGACACGGTCACCGGCCAGTTCTCGACGCCCCTGGGGA
>
GCAGCGTCGGTGGGGACACCAGCACCACCTCGGCCCCGAGGGTGTGCAGCAGCGTCACGTTGGAGCGGGCCACGCG
> GCTGTGCAGCACGTCGCCGACGATCACCACGCGCTTGCCCTCGACGCTG
> 
> Sun May 14 17:34:45 2006
> 
> Chris
> 
> > -----Original Message-----
> > From: bioperl-l-bounces at lists.open-bio.org
> [mailto:bioperl-l-
> > bounces at lists.open-bio.org] On Behalf Of chen li
> > Sent: Sunday, May 14, 2006 12:15 PM
> > To: bioperl-l at bioperl.org
> > Subject: [Bioperl-l] no revcom method in Bio::Seq
> module?
> > 
> > Hi all,
> > 
> > I need to get a reverse-complemenary sequence out
> of a
> > fasta sequence file. And the Synopsis of Bio::Seq
> > points out I can do like this way:
> > 
> > $revcom=$seqobj->revcom();
> > 
> > I use the following script trying to get the job
> done
> > but it doesn't work. Then I read documentation of
> > Bio::Seq and it looks like it doesn't contain
> revcom
> > method.
> > 
> > Any idea will be appreciated.
> > 
> > Li
> > 
> > 
> > ###############################
> > Here is the code:
> > 
> > #!c:/perl/bin/perl.exe
> > use strict;
> > use warnings;
> > 
> > use Bio::Seq;
> > use Bio::SeqIO;
> > 
> > my
> $file='c:/perl/local/primer3_1.0.0/src/est.txt';
> > 
> > 
> > my $seqIO=Bio::SeqIO->new(-file=>"<$file",
> >                             -format=>'fasta' );
> > 
> >     my $seqobj=$seqIO->next_seq();#create object
> > 
> >   print "what attributes/keys are available:\n";
> >   for my $key (sort keys %$seqobj){
> >            my $value=$seqobj->{$key};
> > 	    print "$key\t=>\t$value\n"
> > 	    }
> > # These are the output on the screen
> > #primary_id =>      gi|54093|emb|X61809.1|
> > #primary_seq =>    
> Bio::PrimarySeq=HASH(0x10492848)
> > 
> > #based on these results primary_id can get
> > #access right away
> > # as to primary_seq it is an object in
> > #Bio::Primaryseq and it provides the following
> > #methods after reading the documentaion:
> >                 #new
> > 		#seq
> > 		#validate_seq
> > 		#subseq
> > 		#length
> > 		#display_id
> > 		#accession_number
> > 		#primary_id
> > 		#alphabet
> > 		#desc
> > 		#can_call_new
> > 		#id
> > 		#is_circular
> > 		#object_id
> > 		#version
> > 		#authority
> > 		#namespace
> > 		#display_name
> > 		#description
> > 
> > print "primary_id=",$seqobj->primary_id, "\n\n";
> > print "id=",$seqobj->id, "\n\n";
> > print "revcom=",$seqobj->revcom,"\n\n";
> > 
> >         my $now_time=localtime;
> >         print  $now_time, "\n\n";
> >         exit;
> > 
> >  #These are the output on the screen
> > 	#primary_id=gi|54093|emb|X61809.1|
> > 	#id=gi|54093|emb|X61809.1
> > 	#revcom=Bio::Seq=HASH(0x10493304)
> > 	#Sun May 14 12:45:20 2006
> > 
> > 
> > 
> > __________________________________________________
> > Do You Yahoo!?
> > Tired of spam?  Yahoo! Mail has the best spam
> protection around
> > http://mail.yahoo.com
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> >
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 


__________________________________________________
Do You Yahoo!?
Tired of spam?  Yahoo! Mail has the best spam protection around 
http://mail.yahoo.com