[Bioperl-l] Tested-OK
Guojun Yang
gyang at plantbio.uga.edu
Mon Feb 20 22:22:28 UTC 2006
Chris, I tested the latest fix for blast.pm on my linux with blastn. It worked very well although my CGI script still not returning what I need, but it's not related to this parsing of blast results I think. Thanks for your great efforts.
Guojun
----- Original Message -----
From: Chris Fields [mailto:cjfields at uiuc.edu]
To: 'Chris Fields' [mailto:cjfields at uiuc.edu], 'Pieter Monsieurs' [mailto:Pieter.Monsieurs at esat.kuleuven.be], gyang at plantbio.uga.edu
Cc: bioperl-l at lists.open-bio.org
Subject: RE: [Bioperl-l] OK for aa seq but not a na seq on RemoteBlast.pmversion 1.28
> Guojun Yang pointed out that his BLAST output was still not parsed
> correctly, so I posted another change:
> > http://bugzilla.bioperl.org/show_bug.cgi?id=1934
> > The direct link for the module is:
> > http://bugzilla.bioperl.org/attachment.cgi?id=289&action=view
> > Note that all caveats (can't sue if computer blows up, this is a very
> preliminary bugfix, etc.) apply.
> > Apparently, NCBI has changed blastn and tblastx output to show features in
> the region for each HSP, starting with the either one of the following
> lines:
> > Features in this part of subject sequence:
> Features flanking this part of subject sequence:
> > If you're using Bio::SearchIO::blast previous to Dec. 2005, BLAST 2.2.13,
> most blastn or tblastx report parsing seems to choke on these lines, unless
> you are pretty lucky. This extra little feature was introduced a while back
> for large contigs and chromosomes (~BLAST 2.2.10) but was not set by default
> and hadn't starting affecting web output until this last fall. The first
> fix I posted caught only the first version but not the second
> > The fix included a loop with debugging output to bypass this for now. If
> you use SearchIO directly for parsing (not through RemoteBlast) you can see
> the bypassed lines by setting the '-verbose' flag to 1.
> > Thanks to Guojun Yang for pointing this out.
> > Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
> > > > -----Original Message-----
> > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > bounces at lists.open-bio.org] On Behalf Of Chris Fields
> > Sent: Monday, February 20, 2006 11:01 AM
> > To: 'Pieter Monsieurs'; gyang at plantbio.uga.edu
> > Cc: bioperl-l at lists.open-bio.org
> > Subject: Re: [Bioperl-l] OK for aa seq but not a na seq on
> > RemoteBlast.pmversion 1.28
> > > > I have added a preliminary bugfix for the problems seen with nucleotide
> > blast parsing for BLAST 2.2.13 reports. I passed SearchIO::blast through
> > perltidy to space out the blocks (really for my own purposes; it's a
> > pretty
> > complex module). The fix bypasses the extra lines output for blastn and
> > tblastx and now seems to parse the text output for those reports
> > correctly.
> > I tested it using all NCBI BLAST flavors for the last two version of BLAST
> > (2.2.12 and 2.2.13); the fix was simple so shouldn't break any other BLAST
> > report parsing, such as WU-BLAST, RPS-BLAST, or Paracel. It has only been
> > tested on MacOSX at the moment, so I need people out there to test it out
> > on
> > anything they can to make sure it works before committing. I'll be trying
> > it on Windows today. Report back to me and I'll post anything on
> > bugzilla.
> > > > Here it is:
> > > > http://bugzilla.bioperl.org/show_bug.cgi?id=1934
> > > > > > Christopher Fields
> > Postdoctoral Researcher - Switzer Lab
> > Dept. of Biochemistry
> > University of Illinois Urbana-Champaign
> > > > > > > -----Original Message-----
> > > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > > bounces at lists.open-bio.org] On Behalf Of Pieter Monsieurs
> > > Sent: Thursday, February 16, 2006 3:46 AM
> > > To: gyang at plantbio.uga.edu
> > > Cc: bioperl-l at lists.open-bio.org; Chris Fields
> > > Subject: Re: [Bioperl-l] OK for aa seq but not a na seq on
> > RemoteBlast.pm
> > > version 1.28
> > >
> > > Hi,
> > >
> > > I have the same problem with the blast.pm-file.
> > > The people of NCBI added some extra info when giving the Blast-output.
> > > (see e.g. "Features flanking this part..." or "Features in this part
> > > ..."), example added.
> > > The blast.pm module starts looking for the hsp-alignement-information,
> > > but it dies when it hits this Feature-information.
> > >
> > > Pieter
> > >
> > >
> > > >gi|77552765|gb|DP000011.1|
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Nucleotide&
> > > list_uids=77552765&dopt=GenBank> Oryza sativa (japonica cultivar-group)
> > > chromosome 12, complete
> > >
> > > sequence
> > > Length=27492551
> > >
> > > Features flanking this part of subject sequence:
> > >
> > > 3726 bp at 5' side: transposon protein, putative, CACTA, En/Spm sub-
> > class
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=19251479&to=19253693&view=gbwithparts>
> > >
> > > 2655 bp at 3' side: hypothetical protein
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=19260091&to=19260600&view=gbwithparts>
> > >
> > > Score = 36.2 bits (18), Expect = 0.22
> > > Identities = 18/18 (100%), Gaps = 0/18 (0%)
> > > Strand=Plus/Minus
> > >
> > > Query 4 GTACTACTCTACTCTACT 21
> > > ||||||||||||||||||
> > >
> > > Sbjct 19257436 GTACTACTCTACTCTACT 19257419
> > >
> > >
> > > Features flanking this part of subject sequence:
> > >
> > > 2991 bp at 5' side: hypothetical protein
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=27003164&to=27003907&view=gbwithparts>
> > > 1131 bp at 3' side: hypothetical protein
> > >
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=27008046&to=27010752&view=gbwithparts>
> > >
> > > Score = 36.2 bits (18), Expect = 0.22
> > > Identities = 18/18 (100%), Gaps = 0/18 (0%)
> > > Strand=Plus/Minus
> > >
> > > Query 2 ATGTACTACTCTACTCTA 19
> > > ||||||||||||||||||
> > > Sbjct 27006915 ATGTACTACTCTACTCTA 27006898
> > >
> > >
> > >
> > > Features in this part of subject sequence:
> > > DHHC zinc finger domain, putative
> > >
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=17614825&to=17618687&view=gbwithparts>
> > >
> > > Score = 34.2 bits (17), Expect = 0.87
> > > Identities = 17/17 (100%), Gaps = 0/17 (0%)
> > > Strand=Plus/Plus
> > >
> > > Query 5 TACTACTCTACTCTACT 21
> > > |||||||||||||||||
> > > Sbjct 17616437 TACTACTCTACTCTACT 17616453
> > >
> > >
> > >
> > > Features flanking this part of subject sequence:
> > > 102 bp at 5' side: bZIP transcription factor, putative
> > >
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=2774964&to=2775778&view=gbwithparts>
> > > 3740 bp at 3' side: yeast dcp1, putative
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=2779635&to=2782508&view=gbwithparts>
> > >
> > > Score = 32.2 bits (16), Expect =
> > > 3.4
> > > Identities = 16/16 (100%), Gaps = 0/16 (0%)
> > > Strand=Plus/Plus
> > >
> > > Query 7 CTACTCTACTCTACTC 22
> > > ||||||||||||||||
> > > Sbjct 2775880 CTACTCTACTCTACTC 2775895
> > >
> > >
> > > Features flanking this part of subject sequence:
> > >
> > > 21 bp at 5' side: peptide transporter T17F3.11, putative
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=27321354&to=27323117&view=gbwithparts>
> > >
> > > 10230 bp at 3' side: transposon protein, putative, unclassified
> > >
> > <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=77552765&db=Nucleotide
> > > &from=27333383&to=27334285&view=gbwithparts>
> > >
> > > Score = 32.2 bits (16), Expect = 3.4
> > > Identities = 16/16 (100%), Gaps = 0/16 (0%)
> > > Strand=Plus/Minus
> > >
> > > Query 7 CTACTCTACTCTACTC 22
> > >
> > > ||||||||||||||||
> > > Sbjct 27323153 CTACTCTACTCTACTC 27323138
> > >
> > >
> > >
> > >
> > > Guojun Yang wrote:
> > >
> > > >Hi, Chris,
> > > >Finally the remoteblast test script works for the amino.fa query. but
> > > when I try a nucleic acid sequence (see below), Error occurs:
> > > >"
> > > >waiting........
> > > >------------- EXCEPTION -------------
> > > >MSG: no data for midline Features flanking this part of subject
> > > sequence:
> > > >STACK Bio::SearchIO::blast::next_result
> > > /usr/lib/perl5/site_perl/5.8.3/Bio/Searc
> > > hIO/blast.pm:1172
> > > >STACK toplevel remoteblast_test:40
> > > >"
> > > >The query sequence is:
> > > >CTCCCTCCGTCTCAAAATATTTGACGCCGTTGACTTTTTACTAAAAATGTTTGACCGTTC
> > > >GTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTA
> > > >AATATATTTTTATGTATACATATAGTTTTACATATTTCACAAAAAATTTTGAATAAGACG
> > > >AACGGTCAAATATGTTTTAAAAAGTCAACGGTGTCAAACATTTAGAAACGGAGGGAG
> > > >
> > > >The script (basically same as the remoteblast test, I only changed
> > > database to 'nr' and program to 'blastn' and filename to 'ost3'):
> > > >#!/usr/bin/perl
> > > >
> > > >use Bio::SeqIO;
> > > >use Bio::Seq;
> > > >use Bio::Tools::Run::RemoteBlast;
> > > >use Bio::SearchIO;
> > > >use strict;
> > > >my $prog='blastn';
> > > >my $db='nr';
> > > >my $e_val=1e-10;
> > > >my @params=( -prog=>$prog,
> > > > -data=>$db,
> > > > -expect=>$e_val,
> > > > -readmethod=>'SearchIO');
> > > >my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
> > > >
> > > >my $v = 1;
> > > >
> > > >my $str = Bio::SeqIO->new(-file=>'ost3' , -format => 'fasta' );
> > > >
> > > >while (my $input = $str->next_seq()){
> > > > #Blast a sequence against a database:
> > > > #Alternatively, you could pass in a file with many
> > > > #sequences rather than loop through sequence one at a time
> > > > #Remove the loop starting 'while (my $input = $str->next_seq())'
> > > > #and swap the two lines below for an example of that.
> > > > my $r = $factory->submit_blast($input);
> > > > #my $r = $factory->submit_blast('amino.fa');
> > > > print STDERR "waiting..." if( $v > 0 );
> > > > while ( my @rids = $factory->each_rid ) {
> > > > foreach my $rid ( @rids ) {
> > > > my $rc = $factory->retrieve_blast($rid);
> > > > if( !ref($rc) ) {
> > > > if( $rc < 0 ) {
> > > > $factory->remove_rid($rid);
> > > > }
> > > > print STDERR "." if ( $v > 0 );
> > > > sleep 5;
> > > > } else {
> > > > my $result = $rc->next_result();
> > > > #save the output
> > > > my $filename = $result->query_name()."\.out";
> > > > $factory->save_output($filename);
> > > > $factory->remove_rid($rid);
> > > > print "\nQuery Name: ", $result->query_name(), "\n";
> > > > while ( my $hit = $result->next_hit ) {
> > > > next unless ( $v > 0);
> > > > print "\thit name is ", $hit->name, "\n";
> > > > while( my $hsp = $hit->next_hsp ) {
> > > > print "\t\tscore is ", $hsp->score, "\n";
> > > > }
> > > > }
> > > > }
> > > > }
> > > > }
> > > >}
> > > >
> > > >
> > > >Do you think there might still be something in the NCBI output format?
> > > >
> > > >Thank you,
> > > >Guojun
> > > >
> > > >
> > > >
> > > >
> > > >Guojun Yang
> > > >Department of Plant Biology
> > > >University of Georgia
> > > >Tel: 706-542-1857
> > > >Fax: 706-542-1805
> > > >http://www.arches.uga.edu/~guojun
> > > >
> > > >
> > > >
> > > >----- Original Message -----
> > > >From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > >To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
> > > >Subject: FW: [Bioperl-l] more on RemoteBlast.pm version 1.2
> > > >
> > > >
> > > >
> > > >
> > > >>Sorry, forgot to add that I didn't see the regex issue that you
> > > mentioned.
> > > >>It could be a perl-related issue. Try the fixes I mentioned and see
> > > what
> > > >>happens.
> > > >>
> > > >>
> > > >>>Christopher Fields
> > > >>>
> > > >>>
> > > >>Postdoctoral Researcher - Switzer Lab
> > > >>Dept. of Biochemistry
> > > >>University of Illinois Urbana-Champaign
> > > >>
> > > >>
> > > >>>>>-----Original Message-----
> > > >>>>>
> > > >>>>>
> > > >>>From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > >>>Sent: Tuesday, February 14, 2006 12:36 PM
> > > >>>To: 'gyang at plantbio.uga.edu'
> > > >>>Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.2
> > > >>>
> > > >>>
> > > >>>>>It's a good habit to always add single quotes around words. The
> > perl
> > > >>>>>
> > > >>>>>
> > > >>>interpreter may think a single bare word is a subroutine or perlfunc
> > > >>>called with no args so will try to find a subroutine named blastp().
> > > My
> > > >>>debugger actually gives the error that the bare word blastp may
> > > conflict
> > > >>>with a future reserved word. Like you said, 'use strict' will point
> > > that
> > > >>>out.
> > > >>>
> > > >>>
> > > >>>>>As for the regex, it should match all the blast programs at NCBI
> > > (blastp,
> > > >>>>>
> > > >>>>>
> > > >>>blastn, blastx, tblastn, tblastx) and is built-in to make sure
> > nothing
> > > >>>else passes through.
> > > >>>
> > > >>>
> > > >>>>>So, if you are using the script below, there are several errors.
> > The
> > > bare
> > > >>>>>
> > > >>>>>
> > > >>>words for $prog and $db need quotes, and the flags for you @params
> > > array
> > > >>>don't have a dash before them. I get this after adding quotes but
> > > before
> > > >>>adding the dashes to @params:
> > > >>>
> > > >>>
> > > >>>>>C:\Perl\Scripts>test_blast.pl
> > > >>>>>------------- EXCEPTION: Bio::Root::Exception -------------
> > > >>>>>
> > > >>>>>
> > > >>>MSG:
> > > >>>STACK: Error::throw
> > > >>>STACK: Bio::Root::Root::throw C:\Perl\src\bioperl\bioperl-
> > > >>>live/Bio/Root/Root.pm:328
> > > >>>STACK: Bio::Tools::Run::RemoteBlast::submit_parameter
> > > >>>C:\Perl\src\bioperl\bioperl-live/Bio/Tools/Run/RemoteBlast.pm:325
> > > >>>STACK: Bio::Tools::Run::RemoteBlast::new C:\Perl\src\bioperl\bioperl-
> > > >>>live/Bio/Tools/Run/RemoteBlast.pm:256
> > > >>>STACK: C:\Perl\Scripts\test_blast.pl:15
> > > >>>-----------------------------------------------------------
> > > >>>
> > > >>>
> > > >>>>>The last line indicates a problem with this line:
> > > >>>>>my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
> > > >>>>>Changing the @params to this:
> > > >>>>>my @params=( -prog=>$prog,
> > > >>>>>
> > > >>>>>
> > > >>> -data=>$db,
> > > >>> -expect=>$e_val,
> > > >>> -readmethod=>'SearchIO');
> > > >>>
> > > >>>
> > > >>>>>fixes it, and I get output as expected.
> > > >>>>>Christopher Fields
> > > >>>>>
> > > >>>>>
> > > >>>Postdoctoral Researcher - Switzer Lab
> > > >>>Dept. of Biochemistry
> > > >>>University of Illinois Urbana-Champaign
> > > >>>
> > > >>>
> > > >>>>>>>>-----Original Message-----
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>From: Guojun Yang [mailto:gyang at plantbio.uga.edu]
> > > >>>>Sent: Tuesday, February 14, 2006 11:48 AM
> > > >>>>To: Chris Fields; bioperl-l at lists.open-bio.org
> > > >>>>Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.2
> > > >>>>
> > > >>>>Hi, Chris,
> > > >>>>When I tried with the perldoc script, It did not work either. First
> > it
> > > >>>>says $prog can not be bare word if I "use strict". I added quotes on
> > > the
> > > >>>>words, then it says the value for $prog does not match expression
> > > >>>>t?blast[pnx]. Rejecting. STACK ...RemoteBlast.pm 325 and 256. The
> > > >>>>
> > > >>>>
> > > >>>script
> > > >>>
> > > >>>
> > > >>>>is shown below. Why is the expression "t?blast[pnx]"?
> > > >>>>
> > > >>>>#!/usr/bin/perl
> > > >>>>
> > > >>>>use Bio::SeqIO;
> > > >>>>use Bio::Seq;
> > > >>>>use Bio::Tools::Run::RemoteBlast;
> > > >>>>use Bio::SearchIO;
> > > >>>>
> > > >>>>
> > > >>>>my $prog=blastp;
> > > >>>>my $db=swissprot;
> > > >>>>my $e_val=1e-10;
> > > >>>>my @params=( prog=>$prog,
> > > >>>> data=>$db,
> > > >>>> expect=>$e_val,
> > > >>>> readmethod=>'SearchIO');
> > > >>>>my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
> > > >>>>
> > > >>>>my $v = 1;
> > > >>>>
> > > >>>>my $str = Bio::SeqIO->new(-file=>'amino.fa' , -format => 'fasta' );
> > > >>>>
> > > >>>>while (my $input = $str->next_seq()){
> > > >>>> #Blast a sequence against a database:
> > > >>>> #Alternatively, you could pass in a file with many
> > > >>>> #sequences rather than loop through sequence one at a time
> > > >>>> #Remove the loop starting 'while (my $input = $str->next_seq())'
> > > >>>> #and swap the two lines below for an example of that.
> > > >>>> my $r = $factory->submit_blast($input);
> > > >>>> #my $r = $factory->submit_blast('amino.fa');
> > > >>>> print STDERR "waiting..." if( $v > 0 );
> > > >>>> while ( my @rids = $factory->each_rid ) {
> > > >>>> foreach my $rid ( @rids ) {
> > > >>>> my $rc = $factory->retrieve_blast($rid);
> > > >>>> if( !ref($rc) ) {
> > > >>>> if( $rc < 0 ) {
> > > >>>> $factory->remove_rid($rid);
> > > >>>> }
> > > >>>> print STDERR "." if ( $v > 0 );
> > > >>>> sleep 5;
> > > >>>> } else {
> > > >>>> my $result = $rc->next_result();
> > > >>>> #save the output
> > > >>>> my $filename = $result->query_name()."\.out";
> > > >>>> $factory->save_output($filename);
> > > >>>> $factory->remove_rid($rid);
> > > >>>> print "\nQuery Name: ", $result->query_name(), "\n";
> > > >>>> while ( my $hit = $result->next_hit ) {
> > > >>>> next unless ( $v > 0);
> > > >>>> print "\thit name is ", $hit->name, "\n";
> > > >>>> while( my $hsp = $hit->next_hsp ) {
> > > >>>> print "\t\tscore is ", $hsp->score, "\n";
> > > >>>> }
> > > >>>> }
> > > >>>> }
> > > >>>> }
> > > >>>> }
> > > >>>>}
> > > >>>>
> > > >>>>Thank you for your help!
> > > >>>>
> > > >>>>
> > > >>>>Guojun
> > > >>>>Department of Plant Biology
> > > >>>>University of Georgia
> > > >>>>
> > > >>>>----- Original Message -----
> > > >>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > >>>>To: gyang at plantbio.uga.edu
> > > >>>>Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.28
> > > >>>>
> > > >>>>
> > > >>>>
> > > >>>>
> > > >>>>>Try two things:
> > > >>>>>
> > > >>>>>
> > > >>>>>>1) Use a much simpler script, like the one in 'perldoc
> > > >>>>>>
> > > >>>>>>
> > > >>>>>Bio::Tools::Run::RemoteBlast'. If this fixes it, there's something
> > > >>>>>
> > > >>>>>
> > > >>>>wrong
> > > >>>>
> > > >>>>
> > > >>>>>with the logic in your subroutine:
> > > >>>>>
> > > >>>>>
> > > >>>>>>my $v = 1;
> > > >>>>>>my $str = Bio::SeqIO->new(-file=>'amino.fa' , -format => 'fasta'
> > );
> > > >>>>>>while (my $input = $str->next_seq()){
> > > >>>>>>
> > > >>>>>>
> > > >>>>> #Blast a sequence against a database:
> > > >>>>> #Alternatively, you could pass in a file with many
> > > >>>>> #sequences rather than loop through sequence one at a time
> > > >>>>> #Remove the loop starting 'while (my $input = $str->next_seq())'
> > > >>>>> #and swap the two lines below for an example of that.
> > > >>>>> my $r = $factory->submit_blast($input);
> > > >>>>> #my $r = $factory->submit_blast('amino.fa');
> > > >>>>> print STDERR "waiting..." if( $v > 0 );
> > > >>>>> while ( my @rids = $factory->each_rid ) {
> > > >>>>> foreach my $rid ( @rids ) {
> > > >>>>> my $rc = $factory->retrieve_blast($rid);
> > > >>>>> if( !ref($rc) ) {
> > > >>>>> if( $rc < 0 ) {
> > > >>>>> $factory->remove_rid($rid);
> > > >>>>> }
> > > >>>>> print STDERR "." if ( $v > 0 );
> > > >>>>> sleep 5;
> > > >>>>> } else {
> > > >>>>> my $result = $rc->next_result();
> > > >>>>> #save the output
> > > >>>>> my $filename = $result->query_name()."\.out";
> > > >>>>> $factory->save_output($filename);
> > > >>>>> $factory->remove_rid($rid);
> > > >>>>> print "\nQuery Name: ", $result->query_name(), "\n";
> > > >>>>> while ( my $hit = $result->next_hit ) {
> > > >>>>> next unless ( $v > 0);
> > > >>>>> print "\thit name is ", $hit->name, "\n";
> > > >>>>> while( my $hsp = $hit->next_hsp ) {
> > > >>>>> print "\t\tscore is ", $hsp->score, "\n";
> > > >>>>> }
> > > >>>>> }
> > > >>>>> }
> > > >>>>> }
> > > >>>>> }
> > > >>>>>}
> > > >>>>>
> > > >>>>>
> > > >>>>>>2) Try the RemoteBlast from Bugzilla and see if that works. It
> > > >>>>>>
> > > >>>>>>
> > > >>>really
> > > >>>
> > > >>>
> > > >>>>>shouldn't make that much of a difference, but I noticed that the
> > CVS
> > > >>>>>RemoteBlast (1.28) was changed in Dec 2005, after bioperl-1.5.1 was
> > > >>>>>released; the Bugzilla version is based off CVS.
> > > >>>>>
> > > >>>>>
> > > >>>>>>Christopher Fields
> > > >>>>>>
> > > >>>>>>
> > > >>>>>Postdoctoral Researcher - Switzer Lab
> > > >>>>>Dept. of Biochemistry
> > > >>>>>University of Illinois Urbana-Champaign
> > > >>>>>
> > > >>>>>
> > > >>>>>>>-----Original Message-----
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > > >>>>>>bounces at lists.open-bio.org] On Behalf Of Guojun Yang
> > > >>>>>>Sent: Monday, February 13, 2006 3:00 PM
> > > >>>>>>To: bioperl-l at lists.open-bio.org
> > > >>>>>>Subject: Re: [Bioperl-l] more on RemoteBlast.pm version 1.28
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>Thanks, Chris,
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>I installed version 1.5.1 and replaced the blast.pm file with the
> > > >>>>>>
> > > >>>>>>
> > > >>>one
> > > >>>
> > > >>>
> > > >>>>from
> > > >>>>
> > > >>>>
> > > >>>>>>your bug report. The running version is 1.5 when I use the command
> > > >>>>>>
> > > >>>>>>
> > > >>>you
> > > >>>
> > > >>>
> > > >>>>>>sent me. But when I tried the script, it doesn't change much. My
> > > >>>>>>remoteblast code (portion) is here:
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>sub search {
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>local
> > $Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'}="$ORGN";
> > > >>>>>>local $Bio::Tools::Run::RemoteBlast::HEADER{'WORD_SIZE'}=7;
> > > >>>>>>local $Bio::Tools::Run::RemoteBlast::HEADER{'HITLIST_SIZE'}=5000;
> > > >>>>>>local
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>
> > >
> > >>>$Bio::Tools::Run::RemoteBlast::HEADER{'COMPOSITION_BASED_STATISTICS'}=
> > > >>>
> > > >>>
> > > >>>>>>'no';
> > > >>>>>>local $Bio::Tools::Run::RemoteBlast::HEADER{'GAPCOSTS'}='3 1';
> > > >>>>>>my $query = Bio::Seq -> new ( -seq=>"$_[0]",
> > > >>>>>> -id=>"query",
> > > >>>>>> -desc=>"new seq");
> > > >>>>>>my $len=$query->length();
> > > >>>>>>@db=('nr','htgs','wgs');
> > > >>>>>>foreach my $db (@db) {
> > > >>>>>>my $factory = Bio::Tools::Run::RemoteBlast->new('-prog'
> > =>'blastn',
> > > >>>>>> '-data' =>"$db",
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>
> > > >>'-expect'=>"$E_value");
> > > >>
> > > >>
> > > >>>>>>>>>>my $blast_report = $factory->submit_blast($query);
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>my @rids = $factory->each_rid();
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>foreach my $rid ( @rids ) {
> > > >>>>>> print STDERR "$rid\n";
> > > >>>>>>}
> > > >>>>>># RID = Remote Blast ID (e.g: 1017772174-16400-6638)
> > > >>>>>>print STDERR "waiting...";
> > > >>>>>>sleep 60;
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>foreach my $rid ( @rids ) {
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>> my $rc = $factory->retrieve_blast($rid);
> > > >>>>>> while (!ref($rc) ) {
> > > >>>>>> if( $rc < 0 ) {
> > > >>>>>># retrieve_blast returns -1 on error
> > > >>>>>> $factory->remove_rid($rid);
> > > >>>>>> print "Error!\n";
> > > >>>>>> send_error($email,$function,$seqname,$queryname[$ST]);
> > > >>>>>> die "Can't retrieve $rid";
> > > >>>>>> } if ($rc==0) { # retrieve_blast returns 0 on 'job not
> > > >>>>>>
> > > >>>>>>
> > > >>>finished'
> > > >>>
> > > >>>
> > > >>>>>> sleep 60;
> > > >>>>>> $rc = $factory->retrieve_blast($rid);
> > > >>>>>> }
> > > >>>>>> }
> > > >>>>>> if (ref($rc)) {
> > > >>>>>> print STDERR "Done.\n";
> > > >>>>>> while( my $result = $rc->next_result) {
> > > >>>>>> while( my $hit = $result->next_hit()) {
> > > >>>>>> $hit_name=$hit->name;
> > > >>>>>> $hit_name =~ /\S+[|](\S+)[.]\d+[|].*/;
> > > >>>>>> $name=$1;
> > > >>>>>> @left_plus_start=();
> > > >>>>>> @left_plus_end=();
> > > >>>>>> @left_minus_start=();
> > > >>>>>> @left_minus_end=();
> > > >>>>>> @right_plus_start=();
> > > >>>>>> @right_plus_end=();
> > > >>>>>> @right_minus_start=();
> > > >>>>>> @right_minus_end=();
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>> if (!($name =~ /^[a-zA-Z][a-zA-Z]\_\d{6}/i)) {
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>> while( my $hsp = $hit->next_hsp()) {
> > > >>>>>>......
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>It was working quite well before around October laster year, but
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>it has
> > > >>>>
> > > >>>>
> > > >>>>>>stopped since then, When a submission is sent via a webpage, the
> > cgi
> > > >>>>>>starts to work and use a memory of ~20 Mb. Then it hangs there,
> > > >>>>>>
> > > >>>>>>
> > > >>>>finally
> > > >>>>
> > > >>>>
> > > >>>>>>the expected email is received but without real results although
> > it
> > > >>>>>>
> > > >>>>>>
> > > >>>>does
> > > >>>>
> > > >>>>
> > > >>>>>>contain something from other parts of the script. Apparently the
> > > >>>>>>
> > > >>>>>>
> > > >>>>search
> > > >>>>
> > > >>>>
> > > >>>>>>sub did not return anything (I know there is something should be
> > > >>>>>>returned.). Is it also possible the format of the NCBI output for
> > > >>>>>>
> > > >>>>>>
> > > >>>each
> > > >>>
> > > >>>
> > > >>>>>>result has changed?
> > > >>>>>>Thank you,
> > > >>>>>>Guojun
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>Department of Plant Biology
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>University of Georgia
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>>>----- Original Message -----
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > >>>>>>To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
> > > >>>>>>Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.28
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>>How do you know two versions are installed (i.e. how are
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>you
> > > >>>
> > > >>>
> > > >>>>checking
> > > >>>>
> > > >>>>
> > > >>>>>>the
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>version)? Do you see have two complete bioperl distributions (in
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>two
> > > >>>>
> > > >>>>
> > > >>>>>>>separate directories) or are you looking in modules? Here's the
> > > >>>>>>>
> > > >>>>>>>
> > > >>>way
> > > >>>
> > > >>>
> > > >>>>to
> > > >>>>
> > > >>>>
> > > >>>>>>>check the version (from the FAQ):
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>>>perl -MBio::Root::Version -e 'print
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>$Bio::Root::Version::VERSION,"\n"'
> > > >>>>
> > > >>>>
> > > >>>>>>>>If you have two full bioperl distributions on your computer,
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>normally
> > > >>>>
> > > >>>>
> > > >>>>>>only
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>one will be in use unless you have explicitly set the environment
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>variable
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>PERL5LIB. The PERL5LIB directories will be searched first
> > before
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>your
> > > >>>>
> > > >>>>
> > > >>>>>>>normal perl directory list (@INC) is searched. You MAY get some
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>mixing
> > > >>>>
> > > >>>>
> > > >>>>>>>then, but only if perl can't find a particular module in the path
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>designated
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>in PERL5LIB; then it will progress through the directories listed
> > > >>>>>>>
> > > >>>>>>>
> > > >>>in
> > > >>>
> > > >>>
> > > >>>>>>@INC.
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>This may happen if a module is unique to a particular release,
> > but
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>shouldn't
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>happen for the majority of modules, including RemoteBlast. You
> > > >>>>>>>
> > > >>>>>>>
> > > >>>can
> > > >>>
> > > >>>
> > > >>>>>>check
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>what @INC and PERL5LIB are set to by using 'perl -V'. @INC will
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>differ
> > > >>>>
> > > >>>>
> > > >>>>>>>depending on your OS, perl build, etc.
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>>>Regardless, if you follow the directions for installing bioperl
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>for
> > > >>>>
> > > >>>>
> > > >>>>>>your
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>system ('perl Makefile.PL', 'make', 'make test', 'make install',
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>unless
> > > >>>>
> > > >>>>
> > > >>>>>>you
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>explicitly change the installation directory when using 'perl
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>Makefile.PL'),
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>then 'uninstalling' Bioperl shouldn't be a problem as it will
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>install
> > > >>>>
> > > >>>>
> > > >>>>>>the
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>Bioperl distribution you downloaded over the old version in @INC.
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>See
> > > >>>>
> > > >>>>
> > > >>>>>>this
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>page:
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>>>http://bioperl.open-bio.org/SRC/bioperl-live/INSTALL
> > > >>>>>>>>for more details.
> > > >>>>>>>>Christopher Fields
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>Postdoctoral Researcher - Switzer Lab
> > > >>>>>>>Dept. of Biochemistry
> > > >>>>>>>University of Illinois Urbana-Champaign
> > > >>>>>>>
> > > >>>>>>>
> > > >>>>>>>>>>-----Original Message-----
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > > >>>>>>>>bounces at lists.open-bio.org] On Behalf Of Guojun Yang
> > > >>>>>>>>Sent: Monday, February 13, 2006 12:32 PM
> > > >>>>>>>>To: bioperl-l at lists.open-bio.org
> > > >>>>>>>>Subject: [Bioperl-l] more on RemoteBlast.pm version 1.28
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>Hi, Chris,
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>I do have different versions of bioperl on my Linux machine
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>(1.4.
> > > >>>
> > > >>>
> > > >>>>and
> > > >>>>
> > > >>>>
> > > >>>>>>>>1.5.0), this may be the problem. Should I just install bioperl-
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>1.5.1
> > > >>>>
> > > >>>>
> > > >>>>>>or I
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>need to uninstall and remove the previous versions. I could not
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>find
> > > >>>>
> > > >>>>
> > > >>>>>>any
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>hint on uninstalling bioperl on linux. Could you please give me
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>some
> > > >>>>
> > > >>>>
> > > >>>>>>>>suggestion?
> > > >>>>>>>>Thanks,
> > > >>>>>>>>Guojun
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>Department of Plant Biology
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>University of Georgia
> > > >>>>>>>> _____
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>> From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
> > > >>>>>>>>Sent: Mon, 13 Feb 2006 11:45:14 -0500
> > > >>>>>>>>Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>version
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>1.28
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>>>>>If you're using RemoteBlast 1.28, then you've likely
> > > >>>>>>>>>>>>>>
> > > >>>>>>>>>>>>>>
> > > >>>>>>updated from CVS
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>which isn't the latest fix.
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>Make sure that you check the following:
> > > >>>>>>>>>>1) Always post to the mailing list:
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>http://www.bioperl.org/wiki/HOWTO:Beginners#Getting_Assistance .
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>2) You must have the complete bioperl-1.5.1 or bioperl-live
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>(CVS)
> > > >>>>
> > > >>>>
> > > >>>>>>>>installed first. Perform a clean installation; do not upgrade
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>only
> > > >>>>
> > > >>>>
> > > >>>>>>>>Bio::SearchIO::blast and Bio::Tools::Run::RemoteBlast, as we
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>can't
> > > >>>
> > > >>>
> > > >>>>>>>>guarantee that mixing modules from old and new distributions
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>(1.4
> > > >>>
> > > >>>
> > > >>>>and
> > > >>>>
> > > >>>>
> > > >>>>>>>>1.5.1, for instance) will work. A bioperl-1.5.1 or bioperl-live
> > > >>>>>>>>installation will allow text output from BLAST v.2.2.12 to be
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>saved
> > > >>>>
> > > >>>>
> > > >>>>>>and
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>parsed; it will not parse the newest BLAST text output from NCBI
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>(v2.2.13)
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>but it should still save it. I believe as long as next_results()
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>isn't
> > > >>>>
> > > >>>>
> > > >>>>>>>>called, it will work.
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>3) The bug fixes for the above issue with parsing BLAST
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>2.2.13
> > > >>>
> > > >>>
> > > >>>>>>text output
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>are NOT in CVS; they haven't been cleared and checked in by
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>Roger
> > > >>>
> > > >>>
> > > >>>>Hall
> > > >>>>
> > > >>>>
> > > >>>>>>>>(who's now taking care of RemoteBlast) and the powers that be
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>(Jason
> > > >>>>
> > > >>>>
> > > >>>>>>or
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>whomever is in charge of Bio::SearchIO). They can be found in
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>Bugzilla:
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>http://bugzilla.bioperl.org/show_bug.cgi?id=1934
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>http://bugzilla.bioperl.org/show_bug.cgi?id=1935
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>The fix in RemoteBlast in Bugzilla (#1935) is to allow the
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>option
> > > >>>>
> > > >>>>
> > > >>>>>>of
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>saving XML output, so isn't necessary if you don't plan on using
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>this
> > > >>>>
> > > >>>>
> > > >>>>>>>>option. And, remember, they haven't been committed yet to CVS,
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>which
> > > >>>>
> > > >>>>
> > > >>>>>>>>means that the final version will change to refle the new
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>version.
> > > >>>
> > > >>>
> > > >>>>>>>>>>>>Christopher Fields
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>>>>>Postdoctoral Researcher - Switzer Lab
> > > >>>>>>>>Dept. of Biochemistry
> > > >>>>>>>>University of Illinois Urbana-Champaign
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>>> _____
> > > >>>>>>>>>>>>From: Guojun Yang [mailto:gyang at plantbio.uga.edu]
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>>>>>Sent: Monday, February 13, 2006 9:26 AM
> > > >>>>>>>>To: Chris Fields
> > > >>>>>>>>Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>version
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>1.28
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>>>Hi, Chris
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>Thanks for your suggestion, however, it doesn't seem to work
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>for
> > > >>>>
> > > >>>>
> > > >>>>>>my cgi
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>even after I replace both blast.pm and RemoteBlast.pm. I didn't
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>even
> > > >>>>
> > > >>>>
> > > >>>>>>get
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>any RID. Is there any suggestion?
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>>>>>Guojun
> > > >>>>>>>>>>>>>>
> > > >>>>>>>>>>>>>>
> > > >>>>>>>>>>>>Guojun Yang
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>>>>>Department of Plant Biology
> > > >>>>>>>>University of Georgia
> > > >>>>>>>>Tel: 706-542-1857
> > > >>>>>>>>Fax: 706-542-1805
> > > >>>>>>>>http://www.arches.uga.edu/~guojun
> > > >>>>>>>> _____
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>>>>>To: gyang at plantbio.uga.edu, bioperl-l at bioperl.org
> > > >>>>>>>>Sent: Fri, 03 Feb 2006 16:07:29 -0500
> > > >>>>>>>>Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>version
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>1.28
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>I would say give the new code a try, but realize that it
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>hasn't
> > > >>>>
> > > >>>>
> > > >>>>>>been
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>checked
> > > >>>>>>>>in (like I said below). I will try going over the modified
> > > >>>>>>>>Bio::SearchIO::blast again this weekend to see if there is
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>anything I
> > > >>>>
> > > >>>>
> > > >>>>>>>>might
> > > >>>>>>>>have missed. The changed order in the header of BLAST text
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>output
> > > >>>
> > > >>>
> > > >>>>has
> > > >>>>
> > > >>>>
> > > >>>>>>me a
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>bit worried that it might not catch everything, but it at least
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>doesn't
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>hang
> > > >>>>>>>>in the while() loop I described in the bug report below (bug
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>#1934)
> > > >>>>
> > > >>>>
> > > >>>>>>and
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>seems to process everything fine.
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>If you want more stability in the code, you might consider
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>changing over
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>to
> > > >>>>>>>>XML output and parsing with Bio::SearchIO::blastxml. There are
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>some
> > > >>>>
> > > >>>>
> > > >>>>>>>>changes
> > > >>>>>>>>in Bio::Tools::Run::RemoteBlast (bug #1935) that accommodate
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>saving
> > > >>>>
> > > >>>>
> > > >>>>>>XML
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>output, but I believe it parses everything regardless. If you
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>look
> > > >>>
> > > >>>
> > > >>>>>>back
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>the
> > > >>>>>>>>last month or so there has been a bit of discussion here about
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>it.
> > > >>>
> > > >>>
> > > >>>>>>Jason
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>describes a bit on how to set up RemoteBlast for XML:
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>http://bioperl.org/news/2005/11/06/getting-blastxml-using-
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>remoteblast/
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>Christopher Fields
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>Postdoctoral Researcher - Switzer Lab
> > > >>>>>>>>Dept. of Biochemistry
> > > >>>>>>>>University of Illinois Urbana-Champaign
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>>-----Original Message-----
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>>>>>>>From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > > >>>>>>>>>bounces at lists.open-bio.org] On Behalf Of Guojun Yang
> > > >>>>>>>>>Sent: Friday, February 03, 2006 1:45 PM
> > > >>>>>>>>>To: bioperl-l at bioperl.org
> > > >>>>>>>>>Subject: [Bioperl-l] more question regarding RemoteBlast.pm
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>version
> > > >>>>
> > > >>>>
> > > >>>>>>1.28
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>Hi, Everybody,
> > > >>>>>>>>>I see this post and am wondering if this is the reason for the
> > > >>>>>>>>>malfunctionning of my webserver. We set up a webserver named
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>MAK,
> > > >>>>
> > > >>>>
> > > >>>>>>for
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>MITE
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>sequence analysis. It was working very well until around
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>November
> > > >>>>
> > > >>>>
> > > >>>>>>2005,
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>when it stopped returning any result (the site is fine and
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>seems
> > > >>>
> > > >>>
> > > >>>>to
> > > >>>>
> > > >>>>
> > > >>>>>>be
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>doing sth after submission). In the CGI script, I used
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>remoteblast
> > > >>>>
> > > >>>>
> > > >>>>>>(that
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>work was done in 2003) to do searches. I currently do not have
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>access to
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>the server because I moved. Quite several people sent emails
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>to
> > > >>>
> > > >>>
> > > >>>>us
> > > >>>>
> > > >>>>
> > > >>>>>>about
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>its malfunctioning. Is there any suggestion on fixing the
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>problem?
> > > >>>>
> > > >>>>
> > > >>>>>>>>Should
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>I simplily ask the remoteblast.pm be replaced with the new
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>version?
> > > >>>>
> > > >>>>
> > > >>>>>>>>>Thanks a lot,
> > > >>>>>>>>>Guojun
> > > >>>>>>>>>
> > > >>>>>>>>>Department of Plant Biology
> > > >>>>>>>>>University of Georgia
> > > >>>>>>>>>Tel: 706-542-1857
> > > >>>>>>>>>Fax: 706-542-1805
> > > >>>>>>>>>http://www.arches.uga.edu/~guojun
> > > >>>>>>>>>_____
> > > >>>>>>>>>
> > > >>>>>>>>>From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > >>>>>>>>>To: 'Nagesh Chakka' [mailto:nagesh.chakka at anu.edu.au], 'Huang
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>Jian'
> > > >>>>
> > > >>>>
> > > >>>>>>>>>[mailto:hjian at kuicr.kyoto-u.ac.jp], 'bioperl-l'
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>[mailto:bioperl-
> > > >>>
> > > >>>
> > > >>>>>>>>>l at bioperl.org]
> > > >>>>>>>>>Sent: Fri, 03 Feb 2006 10:45:23 -0500
> > > >>>>>>>>>Subject: Re: [Bioperl-l] RemoteBlast.pm version 1.28
> > > >>>>>>>>>
> > > >>>>>>>>>Like Nagesh says, try the latest RemoteBlast from bioperl-live
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>CVS.
> > > >>>>
> > > >>>>
> > > >>>>>>It
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>will
> > > >>>>>>>>>work for saving text output. However, it will not parse
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>anything
> > > >>>
> > > >>>
> > > >>>>>>using
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>next_result (it will likely hang) and will not save XML
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>format.
> > > >>>
> > > >>>
> > > >>>>See
> > > >>>>
> > > >>>>
> > > >>>>>>>>these
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>bugs:
> > > >>>>>>>>>
> > > >>>>>>>>>http://bugzilla.bioperl.org/show_bug.cgi?id=1934
> > > >>>>>>>>>http://bugzilla.bioperl.org/show_bug.cgi?id=1935
> > > >>>>>>>>>
> > > >>>>>>>>>for explanations and possible fixes (changes to RemoteBlast
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>and
> > > >>>
> > > >>>
> > > >>>>>>>>>Bio::SearchIO::blast). Note that these haven't been checked in
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>yet
> > > >>>>
> > > >>>>
> > > >>>>>>so
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>are
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>still not included in bioperl-live; they may be further
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>modified
> > > >>>
> > > >>>
> > > >>>>>>before
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>committing to CVS. If you're not worried about XML, you could
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>just
> > > >>>>
> > > >>>>
> > > >>>>>>try
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>the
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>first fix, which is a change to SearchIO::blast.
> > > >>>>>>>>>
> > > >>>>>>>>>Nagesh, I remember you posting to the list a month ago using a
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>script
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>which
> > > >>>>>>>>>had problems; the script you used saves the output but doesn't
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>actually
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>parse it (i.e. you don't use next_result() to go through the
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>data).
> > > >>>>
> > > >>>>
> > > >>>>>>Is
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>the
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>version of BLAST in your text output 2.2.12 or 2.2.13? Have
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>you
> > > >>>
> > > >>>
> > > >>>>>>tried
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>parsing the output using "-readmethod => SearchIO" or "-
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>readmethod
> > > >>>>
> > > >>>>
> > > >>>>>>=>
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>blast"
> > > >>>>>>>>>using your version of RemoteBlast and method next_result()?
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>Like
> > > >>>
> > > >>>
> > > >>>>>>below
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>(from
> > > >>>>>>>>>perldoc):
> > > >>>>>>>>>
> > > >>>>>>>>>while ( my @rids = $factory->each_rid ) {
> > > >>>>>>>>>foreach my $rid ( @rids ) {
> > > >>>>>>>>>my $rc = $factory->retrieve_blast($rid);
> > > >>>>>>>>>if( !ref($rc) ) {
> > > >>>>>>>>>if( $rc < 0 ) {
> > > >>>>>>>>>$factory->remove_rid($rid);
> > > >>>>>>>>>}
> > > >>>>>>>>>print STDERR "." if ( $v > 0 );
> > > >>>>>>>>>sleep 5;
> > > >>>>>>>>>} else { # parsing
> > > >>>>>>>>>starts here
> > > >>>>>>>>>my $result = $rc->next_result(); # it should hang
> > > >>>>>>>>>here
> > > >>>>>>>>>#save the output
> > > >>>>>>>>>my $filename = $result->query_name()."\.out";
> > > >>>>>>>>>$factory->save_output($filename);
> > > >>>>>>>>>$factory->remove_rid($rid);
> > > >>>>>>>>>print "\nQuery Name: ", $result->query_name(), "\n";
> > > >>>>>>>>>while ( my $hit = $result->next_hit ) {
> > > >>>>>>>>>next unless ( $v > 0);
> > > >>>>>>>>>print "\thit name is ", $hit->name, "\n";
> > > >>>>>>>>>while( my $hsp = $hit->next_hsp ) {
> > > >>>>>>>>>print "\t\tscore is ", $hsp->score, "\n";
> > > >>>>>>>>>}
> > > >>>>>>>>>}
> > > >>>>>>>>>}
> > > >>>>>>>>>}
> > > >>>>>>>>>}
> > > >>>>>>>>>}
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>>>>My script hanged if I used next_result() in any way prior to
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>the
> > > >>>
> > > >>>
> > > >>>>>>fixes.
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>I
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>want to see how many others are having the same issues with
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>parsing
> > > >>>>
> > > >>>>
> > > >>>>>>>>using
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>the CVS version of bioperl-live.
> > > >>>>>>>>>
> > > >>>>>>>>>Christopher Fields
> > > >>>>>>>>>Postdoctoral Researcher - Switzer Lab
> > > >>>>>>>>>Dept. of Biochemistry
> > > >>>>>>>>>University of Illinois Urbana-Champaign
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>>>>>-----Original Message-----
> > > >>>>>>>>>>From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>l-
> > > >>>
> > > >>>
> > > >>>>>>>>>>bounces at lists.open-bio.org] On Behalf Of Nagesh Chakka
> > > >>>>>>>>>>Sent: Thursday, February 02, 2006 7:24 PM
> > > >>>>>>>>>>To: Huang Jian; bioperl-l
> > > >>>>>>>>>>Subject: Re: [Bioperl-l] RemoteBlast.pm version 1.28
> > > >>>>>>>>>>
> > > >>>>>>>>>>Hi Huang,
> > > >>>>>>>>>>Thanks for the message. The older version of RemoteBlast.pm
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>works
> > > >>>>
> > > >>>>
> > > >>>>>>on
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>the
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>logic of checking the temporary file size to determine
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>whether
> > > >>>
> > > >>>
> > > >>>>the
> > > >>>>
> > > >>>>
> > > >>>>>>>>Blast
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>results are ready. This condition is not getting satisfied
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>may
> > > >>>
> > > >>>
> > > >>>>be
> > > >>>>
> > > >>>>
> > > >>>>>>due
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>to
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>some changes brought about by NCBI. I had this problem
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>recently
> > > >>>>
> > > >>>>
> > > >>>>>>and
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>figured out that the solution was to use the latest version
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>which
> > > >>>>
> > > >>>>
> > > >>>>>>has
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>this problem fixed (does not use file size logic any more)
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>which
> > > >>>>
> > > >>>>
> > > >>>>>>is
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>not
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>yet included in the BioPerl package.
> > > >>>>>>>>>>Cheers
> > > >>>>>>>>>>Nagesh
> > > >>>>>>>>>>
> > > >>>>>>>>>>Huang Jian wrote:
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>>>>Dear Nagesh,
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>I have replaced my old RemoteBlast.pm (v 1.17) with v 1.28
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>>you
> > > >>>>
> > > >>>>
> > > >>>>>>send
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>>me. Now it works perfectly!!!
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>Thank you!!
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>Huang
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>----- Original Message ----- From: "Nagesh Chakka"
> > > >>>>>>>>>>><nagesh.chakka at anu.edu.au>
> > > >>>>>>>>>>>To: "Huang Jian" <hjian at kuicr.kyoto-u.ac.jp>; "bioperl-l"
> > > >>>>>>>>>>><bioperl-l at bioperl.org>
> > > >>>>>>>>>>>Sent: Friday, February 03, 2006 7:48 AM
> > > >>>>>>>>>>>Subject: Re: [Bioperl-l] Sorry, failure in post on the
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>net,
> > > >>>
> > > >>>
> > > >>>>so
> > > >>>>
> > > >>>>
> > > >>>>>>still
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>>>via email
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>>Hi Huang,
> > > >>>>>>>>>>>>I see that you are submitting a sequence for a remote
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>blast
> > > >>>
> > > >>>
> > > >>>>>>search.
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>Can
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>>>>>>>you check if the RemoteBlast.pm being used is v 1.28
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>>>(2005/12/09).
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>If
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>>>>>>>not I have attached it with this email, try to replace it
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>with
> > > >>>>
> > > >>>>
> > > >>>>>>the
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>>old
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>>>>>>>one which has a bug.
> > > >>>>>>>>>>>>Let me know if it works.
> > > >>>>>>>>>>>>Nagesh
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>>>>>>>>>
> > > >>>>>>>>>>_______________________________________________
> > > >>>>>>>>>>Bioperl-l mailing list
> > > >>>>>>>>>>Bioperl-l at lists.open-bio.org
> > > >>>>>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > >>>>>>>>>>
> > > >>>>>>>>>>
> > > >>>>>>>>>_______________________________________________
> > > >>>>>>>>>Bioperl-l mailing list
> > > >>>>>>>>>Bioperl-l at lists.open-bio.org
> > > >>>>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>>>>_______________________________________________
> > > >>>>>>>>>Bioperl-l mailing list
> > > >>>>>>>>>Bioperl-l at lists.open-bio.org
> > > >>>>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > >>>>>>>>>
> > > >>>>>>>>>
> > > >>>>>>_______________________________________________
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>>>Bioperl-l mailing list
> > > >>>>>>>>Bioperl-l at lists.open-bio.org
> > > >>>>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > >>>>>>>>
> > > >>>>>>>>_______________________________________________
> > > >>>>>>>>
> > > >>>>>>>>
> > > >>>>>>Bioperl-l mailing list
> > > >>>>>>Bioperl-l at lists.open-bio.org
> > > >>>>>>http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > >>>>>>
> > > >>>>>>
> > > >>>>>>
> > > >
> > > >_______________________________________________
> > > >Bioperl-l mailing list
> > > >Bioperl-l at lists.open-bio.org
> > > >http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > >
> > > >
> > > >
> > >
> > > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm
> > >
> > > _______________________________________________
> > > Bioperl-l mailing list
> > > Bioperl-l at lists.open-bio.org
> > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> >
More information about the Bioperl-l
mailing list