[Bioperl-l] Primer maps?

[Sean Davis]

Do you mean that you want to use Bio::Graphics to make a picture, or just
map your primers onto a sequence?

Sean



On 2/15/06 4:20 PM, "Michael Coyne" <mcoyne at channing.harvard.edu> wrote:

> Hello all --
> 
> I'm having a devil of a time figuring out how to make restriction maps using
> BioPerl.  What I'm going for is output similar to GCG's map program, but
> instead of using a set of defined restriction enzymes, I'd like to use a set
> of primers, to create a primer map rather than a restriction map.  I do not
> need a table of restriction enzymes that cut or don't cut (or primers that
> match or don't match, in this case), but an honest-to-goodness map, something
> like:
> 
>                                       FKP-5->
>                                             |
>     CGTTCTATCGATATGGGTGCTATGGAAATAGTATCTACGTTTGATGAATTGCAAGATTAT
> 1921 ---------+---------+---------+---------+---------+---------+ 1980
>     GCAAGATAGCTATACCCACGATACCTTTATCATAGATGCAAACTACTTAACGTTCTAATA
>  
> a                        M  E  I  V  S  T  F  D  E L  Q  D  Y   -
> 
> I also need translations of orfs, but I can use GenBank files as input to the
> program and thus the CDS translations are already there, so I'm guessing that
> shouldn't be too hard....  How does one create such a map using the BioPerl
> modules?
> 
> There are intriguing indications out there that such a thing is possible (e.g.
> the Bio::Map:: * and Bio::Restriction:: * modules), but I can't find a single
> example of code that creates such a basic, bread-and-butter thing as a
> restriction map with orf translations.  The documentation to these modules is
> fairly useless to me, consisting mostly of internal methods and function
> prototypes.  Perhaps my skills as a Perl programmer are to blame, but a clear
> example of how a map like this is constructed would be a big help.
> 
> Right now, I'm generating primer maps with system calls to EMBOSS's remap,
> pointing it at a file of primer sequences rather than a file of restriction
> enzyme sequences, but the results are less than desired.  I'm considering
> trying to adapt tacg 4.1.0 or sequence extractor 1.1 web-based code to my
> needs, but this seems like a lot of work for an operation I suspect is
> possible in BioPerl.
> 
> Any help greatly appreciated...
> 
> Mike
> 
> ---------------------------------------------------------------------
>  //=\   Michael J. Coyne                      phone: (617) 525-7820
>  \=//   Channing Laboratory                   FAX:   (617) 264-5193
>   //=\  EBRC, Room 617
>   \=//  221 Longwood Avenue       email:mcoyne at channing.harvard.edu
>    //=\ Boston, MA 02115                mjcoyne at comcast.net
>    \=// 
> ---------------------------------------------------------------------
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l