[Bioperl-l] Primer maps?

[Marc Logghe]

Hi Mike,
Another route you might take is mapping your primers into
Bio::SeqFeature::Generic objects and add them to the seq object. Then
you dump the object into a rich sequence format like genbank and pass
that to EMBOSS's showseq application
Or you might do it completely with showseq. Here the only thing you need
is an annotation file containing the positions of the primers, followed
by any text (e.g. primer name).
Then you do:
showseq  <your seq file> -translate <cds_start>-<cds_stop> -format 4
-annotation <your_primer_file>
Have a look at http://emboss.sourceforge.net/apps/showseq.html for more
options
 
HTH,
Marc
 

Marc Logghe, PhD
Expert Scientist Bioinformatics
deVGen NV
Technologiepark 30
B - 9052 Ghent-Zwijnaarde
Tel. +32 9 324 24 83
Fax. +32 9 324 24 25
Web: www.devgen.com

 --- Disclaimer start ---
This e-mail and any attachments thereto may contain information which is
confidential and/or which is proprietary to the sender. Accordingly,
this e-mail and any attachments thereto, as well as any and all
information contained therein, are intended for the sole use of the
recipient or recipients designated above. Any use of this e-mail, of any
attachments thereto, of any and all information contained therein,
and/or of any part(s) thereof (including, without limitation, total or
partial reproduction, communication and/or distribution in any form) by
persons other than the designated recipient(s) is prohibited. If you
have received this e-mail in error, please notify the sender either by
telephone or by e-mail and delete the material from any computer.
Thank you for your cooperation.
--- Disclaimer end ---
  

 


________________________________

	From: bioperl-l-bounces at lists.open-bio.org
[mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Michael Coyne
	Sent: Wednesday, February 15, 2006 10:20 PM
	To: bioperl-l at lists.open-bio.org
	Subject: [Bioperl-l] Primer maps?
	
	
	Hello all --
	
	I'm having a devil of a time figuring out how to make
restriction maps using BioPerl.  What I'm going for is output similar to
GCG's map program, but instead of using a set of defined restriction
enzymes, I'd like to use a set of primers, to create a primer map rather
than a restriction map.  I do not need a table of restriction enzymes
that cut or don't cut (or primers that match or don't match, in this
case), but an honest-to-goodness map, something like:
	
	                                       FKP-5->
	                                             |
	
CGTTCTATCGATATGGGTGCTATGGAAATAGTATCTACGTTTGATGAATTGCAAGATTAT
	1921
---------+---------+---------+---------+---------+---------+ 1980
	
GCAAGATAGCTATACCCACGATACCTTTATCATAGATGCAAACTACTTAACGTTCTAATA
	 
	a                         M  E  I  V  S  T  F  D  E  L  Q  D  Y
-
	
	I also need translations of orfs, but I can use GenBank files as
input to the program and thus the CDS translations are already there, so
I'm guessing that shouldn't be too hard....  How does one create such a
map using the BioPerl modules?
	
	There are intriguing indications out there that such a thing is
possible (e.g. the Bio::Map:: * and Bio::Restriction:: * modules), but I
can't find a single example of code that creates such a basic,
bread-and-butter thing as a restriction map with orf translations.  The
documentation to these modules is fairly useless to me, consisting
mostly of internal methods and function prototypes.  Perhaps my skills
as a Perl programmer are to blame, but a clear example of how a map like
this is constructed would be a big help.
	
	Right now, I'm generating primer maps with system calls to
EMBOSS's remap, pointing it at a file of primer sequences rather than a
file of restriction enzyme sequences, but the results are less than
desired.  I'm considering trying to adapt tacg 4.1.0 or sequence
extractor 1.1 web-based code to my needs, but this seems like a lot of
work for an operation I suspect is possible in BioPerl.
	
	Any help greatly appreciated...
	
	Mike
	

	
---------------------------------------------------------------------
	 //=\   Michael J. Coyne                       phone: (617)
525-7820
	 \=//   Channing Laboratory                    FAX:   (617)
264-5193
	  //=\  EBRC, Room 617
	  \=//  221 Longwood Avenue
email:mcoyne at channing.harvard.edu
	   //=\ Boston, MA 02115                 mjcoyne at comcast.net
	   \=// 
	
---------------------------------------------------------------------