[Bioperl-l] OK for aa seq but not a na seq on RemoteBlast.pm version 1.28
Guojun Yang
gyang at plantbio.uga.edu
Wed Feb 15 19:39:41 UTC 2006
Hi, Chris,
Finally the remoteblast test script works for the amino.fa query. but when I try a nucleic acid sequence (see below), Error occurs:
"
waiting........
------------- EXCEPTION -------------
MSG: no data for midline Features flanking this part of subject sequence:
STACK Bio::SearchIO::blast::next_result /usr/lib/perl5/site_perl/5.8.3/Bio/Searc hIO/blast.pm:1172
STACK toplevel remoteblast_test:40
"
The query sequence is:
CTCCCTCCGTCTCAAAATATTTGACGCCGTTGACTTTTTACTAAAAATGTTTGACCGTTC
GTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTA
AATATATTTTTATGTATACATATAGTTTTACATATTTCACAAAAAATTTTGAATAAGACG
AACGGTCAAATATGTTTTAAAAAGTCAACGGTGTCAAACATTTAGAAACGGAGGGAG
The script (basically same as the remoteblast test, I only changed database to 'nr' and program to 'blastn' and filename to 'ost3'):
#!/usr/bin/perl
use Bio::SeqIO;
use Bio::Seq;
use Bio::Tools::Run::RemoteBlast;
use Bio::SearchIO;
use strict;
my $prog='blastn';
my $db='nr';
my $e_val=1e-10;
my @params=( -prog=>$prog,
-data=>$db,
-expect=>$e_val,
-readmethod=>'SearchIO');
my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
my $v = 1;
my $str = Bio::SeqIO->new(-file=>'ost3' , -format => 'fasta' );
while (my $input = $str->next_seq()){
#Blast a sequence against a database:
#Alternatively, you could pass in a file with many
#sequences rather than loop through sequence one at a time
#Remove the loop starting 'while (my $input = $str->next_seq())'
#and swap the two lines below for an example of that.
my $r = $factory->submit_blast($input);
#my $r = $factory->submit_blast('amino.fa');
print STDERR "waiting..." if( $v > 0 );
while ( my @rids = $factory->each_rid ) {
foreach my $rid ( @rids ) {
my $rc = $factory->retrieve_blast($rid);
if( !ref($rc) ) {
if( $rc < 0 ) {
$factory->remove_rid($rid);
}
print STDERR "." if ( $v > 0 );
sleep 5;
} else {
my $result = $rc->next_result();
#save the output
my $filename = $result->query_name()."\.out";
$factory->save_output($filename);
$factory->remove_rid($rid);
print "\nQuery Name: ", $result->query_name(), "\n";
while ( my $hit = $result->next_hit ) {
next unless ( $v > 0);
print "\thit name is ", $hit->name, "\n";
while( my $hsp = $hit->next_hsp ) {
print "\t\tscore is ", $hsp->score, "\n";
}
}
}
}
}
}
Do you think there might still be something in the NCBI output format?
Thank you,
Guojun
Guojun Yang
Department of Plant Biology
University of Georgia
Tel: 706-542-1857
Fax: 706-542-1805
http://www.arches.uga.edu/~guojun
----- Original Message -----
From: Chris Fields [mailto:cjfields at uiuc.edu]
To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
Subject: FW: [Bioperl-l] more on RemoteBlast.pm version 1.2
> Sorry, forgot to add that I didn't see the regex issue that you mentioned.
> It could be a perl-related issue. Try the fixes I mentioned and see what
> happens.
> > Christopher Fields
> Postdoctoral Researcher - Switzer Lab
> Dept. of Biochemistry
> University of Illinois Urbana-Champaign
> > > > -----Original Message-----
> > From: Chris Fields [mailto:cjfields at uiuc.edu]
> > Sent: Tuesday, February 14, 2006 12:36 PM
> > To: 'gyang at plantbio.uga.edu'
> > Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.2
> > > > It's a good habit to always add single quotes around words. The perl
> > interpreter may think a single bare word is a subroutine or perlfunc
> > called with no args so will try to find a subroutine named blastp(). My
> > debugger actually gives the error that the bare word blastp may conflict
> > with a future reserved word. Like you said, 'use strict' will point that
> > out.
> > > > As for the regex, it should match all the blast programs at NCBI (blastp,
> > blastn, blastx, tblastn, tblastx) and is built-in to make sure nothing
> > else passes through.
> > > > So, if you are using the script below, there are several errors. The bare
> > words for $prog and $db need quotes, and the flags for you @params array
> > don't have a dash before them. I get this after adding quotes but before
> > adding the dashes to @params:
> > > > C:\Perl\Scripts>test_blast.pl
> > > > ------------- EXCEPTION: Bio::Root::Exception -------------
> > MSG:
> > STACK: Error::throw
> > STACK: Bio::Root::Root::throw C:\Perl\src\bioperl\bioperl-
> > live/Bio/Root/Root.pm:328
> > STACK: Bio::Tools::Run::RemoteBlast::submit_parameter
> > C:\Perl\src\bioperl\bioperl-live/Bio/Tools/Run/RemoteBlast.pm:325
> > STACK: Bio::Tools::Run::RemoteBlast::new C:\Perl\src\bioperl\bioperl-
> > live/Bio/Tools/Run/RemoteBlast.pm:256
> > STACK: C:\Perl\Scripts\test_blast.pl:15
> > -----------------------------------------------------------
> > > > The last line indicates a problem with this line:
> > > > my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
> > > > Changing the @params to this:
> > > > my @params=( -prog=>$prog,
> > -data=>$db,
> > -expect=>$e_val,
> > -readmethod=>'SearchIO');
> > > > fixes it, and I get output as expected.
> > > > Christopher Fields
> > Postdoctoral Researcher - Switzer Lab
> > Dept. of Biochemistry
> > University of Illinois Urbana-Champaign
> > > > > > > -----Original Message-----
> > > From: Guojun Yang [mailto:gyang at plantbio.uga.edu]
> > > Sent: Tuesday, February 14, 2006 11:48 AM
> > > To: Chris Fields; bioperl-l at lists.open-bio.org
> > > Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.2
> > >
> > > Hi, Chris,
> > > When I tried with the perldoc script, It did not work either. First it
> > > says $prog can not be bare word if I "use strict". I added quotes on the
> > > words, then it says the value for $prog does not match expression
> > > t?blast[pnx]. Rejecting. STACK ...RemoteBlast.pm 325 and 256. The
> > script
> > > is shown below. Why is the expression "t?blast[pnx]"?
> > >
> > > #!/usr/bin/perl
> > >
> > > use Bio::SeqIO;
> > > use Bio::Seq;
> > > use Bio::Tools::Run::RemoteBlast;
> > > use Bio::SearchIO;
> > >
> > >
> > > my $prog=blastp;
> > > my $db=swissprot;
> > > my $e_val=1e-10;
> > > my @params=( prog=>$prog,
> > > data=>$db,
> > > expect=>$e_val,
> > > readmethod=>'SearchIO');
> > > my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
> > >
> > > my $v = 1;
> > >
> > > my $str = Bio::SeqIO->new(-file=>'amino.fa' , -format => 'fasta' );
> > >
> > > while (my $input = $str->next_seq()){
> > > #Blast a sequence against a database:
> > > #Alternatively, you could pass in a file with many
> > > #sequences rather than loop through sequence one at a time
> > > #Remove the loop starting 'while (my $input = $str->next_seq())'
> > > #and swap the two lines below for an example of that.
> > > my $r = $factory->submit_blast($input);
> > > #my $r = $factory->submit_blast('amino.fa');
> > > print STDERR "waiting..." if( $v > 0 );
> > > while ( my @rids = $factory->each_rid ) {
> > > foreach my $rid ( @rids ) {
> > > my $rc = $factory->retrieve_blast($rid);
> > > if( !ref($rc) ) {
> > > if( $rc < 0 ) {
> > > $factory->remove_rid($rid);
> > > }
> > > print STDERR "." if ( $v > 0 );
> > > sleep 5;
> > > } else {
> > > my $result = $rc->next_result();
> > > #save the output
> > > my $filename = $result->query_name()."\.out";
> > > $factory->save_output($filename);
> > > $factory->remove_rid($rid);
> > > print "\nQuery Name: ", $result->query_name(), "\n";
> > > while ( my $hit = $result->next_hit ) {
> > > next unless ( $v > 0);
> > > print "\thit name is ", $hit->name, "\n";
> > > while( my $hsp = $hit->next_hsp ) {
> > > print "\t\tscore is ", $hsp->score, "\n";
> > > }
> > > }
> > > }
> > > }
> > > }
> > > }
> > >
> > > Thank you for your help!
> > >
> > >
> > > Guojun
> > > Department of Plant Biology
> > > University of Georgia
> > >
> > > ----- Original Message -----
> > > From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > To: gyang at plantbio.uga.edu
> > > Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.28
> > >
> > >
> > > > Try two things:
> > > > > 1) Use a much simpler script, like the one in 'perldoc
> > > > Bio::Tools::Run::RemoteBlast'. If this fixes it, there's something
> > > wrong
> > > > with the logic in your subroutine:
> > > > > my $v = 1;
> > > > > my $str = Bio::SeqIO->new(-file=>'amino.fa' , -format => 'fasta' );
> > > > > while (my $input = $str->next_seq()){
> > > > #Blast a sequence against a database:
> > > > #Alternatively, you could pass in a file with many
> > > > #sequences rather than loop through sequence one at a time
> > > > #Remove the loop starting 'while (my $input = $str->next_seq())'
> > > > #and swap the two lines below for an example of that.
> > > > my $r = $factory->submit_blast($input);
> > > > #my $r = $factory->submit_blast('amino.fa');
> > > > print STDERR "waiting..." if( $v > 0 );
> > > > while ( my @rids = $factory->each_rid ) {
> > > > foreach my $rid ( @rids ) {
> > > > my $rc = $factory->retrieve_blast($rid);
> > > > if( !ref($rc) ) {
> > > > if( $rc < 0 ) {
> > > > $factory->remove_rid($rid);
> > > > }
> > > > print STDERR "." if ( $v > 0 );
> > > > sleep 5;
> > > > } else {
> > > > my $result = $rc->next_result();
> > > > #save the output
> > > > my $filename = $result->query_name()."\.out";
> > > > $factory->save_output($filename);
> > > > $factory->remove_rid($rid);
> > > > print "\nQuery Name: ", $result->query_name(), "\n";
> > > > while ( my $hit = $result->next_hit ) {
> > > > next unless ( $v > 0);
> > > > print "\thit name is ", $hit->name, "\n";
> > > > while( my $hsp = $hit->next_hsp ) {
> > > > print "\t\tscore is ", $hsp->score, "\n";
> > > > }
> > > > }
> > > > }
> > > > }
> > > > }
> > > > }
> > > > > 2) Try the RemoteBlast from Bugzilla and see if that works. It
> > really
> > > > shouldn't make that much of a difference, but I noticed that the CVS
> > > > RemoteBlast (1.28) was changed in Dec 2005, after bioperl-1.5.1 was
> > > > released; the Bugzilla version is based off CVS.
> > > > > Christopher Fields
> > > > Postdoctoral Researcher - Switzer Lab
> > > > Dept. of Biochemistry
> > > > University of Illinois Urbana-Champaign
> > > > > > -----Original Message-----
> > > > > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > > > > bounces at lists.open-bio.org] On Behalf Of Guojun Yang
> > > > > Sent: Monday, February 13, 2006 3:00 PM
> > > > > To: bioperl-l at lists.open-bio.org
> > > > > Subject: Re: [Bioperl-l] more on RemoteBlast.pm version 1.28
> > > > > > > Thanks, Chris,
> > > > > I installed version 1.5.1 and replaced the blast.pm file with the
> > one
> > > from
> > > > > your bug report. The running version is 1.5 when I use the command
> > you
> > > > > sent me. But when I tried the script, it doesn't change much. My
> > > > > remoteblast code (portion) is here:
> > > > > > > sub search {
> > > > > local $Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'}="$ORGN";
> > > > > local $Bio::Tools::Run::RemoteBlast::HEADER{'WORD_SIZE'}=7;
> > > > > local $Bio::Tools::Run::RemoteBlast::HEADER{'HITLIST_SIZE'}=5000;
> > > > > local
> > > > >
> > $Bio::Tools::Run::RemoteBlast::HEADER{'COMPOSITION_BASED_STATISTICS'}=
> > > > > 'no';
> > > > > local $Bio::Tools::Run::RemoteBlast::HEADER{'GAPCOSTS'}='3 1';
> > > > > my $query = Bio::Seq -> new ( -seq=>"$_[0]",
> > > > > -id=>"query",
> > > > > -desc=>"new seq");
> > > > > my $len=$query->length();
> > > > > @db=('nr','htgs','wgs');
> > > > > foreach my $db (@db) {
> > > > > my $factory = Bio::Tools::Run::RemoteBlast->new('-prog' =>'blastn',
> > > > > '-data' =>"$db",
> > > > >
> '-expect'=>"$E_value");
> > > > > > > > > my $blast_report = $factory->submit_blast($query);
> > > > > > > my @rids = $factory->each_rid();
> > > > > foreach my $rid ( @rids ) {
> > > > > print STDERR "$rid\n";
> > > > > }
> > > > > # RID = Remote Blast ID (e.g: 1017772174-16400-6638)
> > > > > print STDERR "waiting...";
> > > > > sleep 60;
> > > > > > > foreach my $rid ( @rids ) {
> > > > > my $rc = $factory->retrieve_blast($rid);
> > > > > while (!ref($rc) ) {
> > > > > if( $rc < 0 ) {
> > > > > # retrieve_blast returns -1 on error
> > > > > $factory->remove_rid($rid);
> > > > > print "Error!\n";
> > > > > send_error($email,$function,$seqname,$queryname[$ST]);
> > > > > die "Can't retrieve $rid";
> > > > > } if ($rc==0) { # retrieve_blast returns 0 on 'job not
> > finished'
> > > > > sleep 60;
> > > > > $rc = $factory->retrieve_blast($rid);
> > > > > }
> > > > > }
> > > > > if (ref($rc)) {
> > > > > print STDERR "Done.\n";
> > > > > while( my $result = $rc->next_result) {
> > > > > while( my $hit = $result->next_hit()) {
> > > > > $hit_name=$hit->name;
> > > > > $hit_name =~ /\S+[|](\S+)[.]\d+[|].*/;
> > > > > $name=$1;
> > > > > @left_plus_start=();
> > > > > @left_plus_end=();
> > > > > @left_minus_start=();
> > > > > @left_minus_end=();
> > > > > @right_plus_start=();
> > > > > @right_plus_end=();
> > > > > @right_minus_start=();
> > > > > @right_minus_end=();
> > > > > > > if (!($name =~ /^[a-zA-Z][a-zA-Z]\_\d{6}/i)) {
> > > > > while( my $hsp = $hit->next_hsp()) {
> > > > > ......
> > > > > > > It was working quite well before around October laster year, but
> > > it has
> > > > > stopped since then, When a submission is sent via a webpage, the cgi
> > > > > starts to work and use a memory of ~20 Mb. Then it hangs there,
> > > finally
> > > > > the expected email is received but without real results although it
> > > does
> > > > > contain something from other parts of the script. Apparently the
> > > search
> > > > > sub did not return anything (I know there is something should be
> > > > > returned.). Is it also possible the format of the NCBI output for
> > each
> > > > > result has changed?
> > > > > Thank you,
> > > > > Guojun
> > > > > > > > > Department of Plant Biology
> > > > > University of Georgia
> > > > > > > > > > > ----- Original Message -----
> > > > > From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > > > To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
> > > > > Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.28
> > > > > > > > > > How do you know two versions are installed (i.e. how are
> > you
> > > checking
> > > > > the
> > > > > > version)? Do you see have two complete bioperl distributions (in
> > > two
> > > > > > separate directories) or are you looking in modules? Here's the
> > way
> > > to
> > > > > > check the version (from the FAQ):
> > > > > > > perl -MBio::Root::Version -e 'print
> > > $Bio::Root::Version::VERSION,"\n"'
> > > > > > > If you have two full bioperl distributions on your computer,
> > > normally
> > > > > only
> > > > > > one will be in use unless you have explicitly set the environment
> > > > > variable
> > > > > > PERL5LIB. The PERL5LIB directories will be searched first before
> > > your
> > > > > > normal perl directory list (@INC) is searched. You MAY get some
> > > mixing
> > > > > > then, but only if perl can't find a particular module in the path
> > > > > designated
> > > > > > in PERL5LIB; then it will progress through the directories listed
> > in
> > > > > @INC.
> > > > > > This may happen if a module is unique to a particular release, but
> > > > > shouldn't
> > > > > > happen for the majority of modules, including RemoteBlast. You
> > can
> > > > > check
> > > > > > what @INC and PERL5LIB are set to by using 'perl -V'. @INC will
> > > differ
> > > > > > depending on your OS, perl build, etc.
> > > > > > > Regardless, if you follow the directions for installing bioperl
> > > for
> > > > > your
> > > > > > system ('perl Makefile.PL', 'make', 'make test', 'make install',
> > > unless
> > > > > you
> > > > > > explicitly change the installation directory when using 'perl
> > > > > Makefile.PL'),
> > > > > > then 'uninstalling' Bioperl shouldn't be a problem as it will
> > > install
> > > > > the
> > > > > > Bioperl distribution you downloaded over the old version in @INC.
> > > See
> > > > > this
> > > > > > page:
> > > > > > > http://bioperl.open-bio.org/SRC/bioperl-live/INSTALL
> > > > > > > for more details.
> > > > > > > Christopher Fields
> > > > > > Postdoctoral Researcher - Switzer Lab
> > > > > > Dept. of Biochemistry
> > > > > > University of Illinois Urbana-Champaign
> > > > > > > > > -----Original Message-----
> > > > > > > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > > > > > > bounces at lists.open-bio.org] On Behalf Of Guojun Yang
> > > > > > > Sent: Monday, February 13, 2006 12:32 PM
> > > > > > > To: bioperl-l at lists.open-bio.org
> > > > > > > Subject: [Bioperl-l] more on RemoteBlast.pm version 1.28
> > > > > > > > > Hi, Chris,
> > > > > > > I do have different versions of bioperl on my Linux machine
> > (1.4.
> > > and
> > > > > > > 1.5.0), this may be the problem. Should I just install bioperl-
> > > 1.5.1
> > > > > or I
> > > > > > > need to uninstall and remove the previous versions. I could not
> > > find
> > > > > any
> > > > > > > hint on uninstalling bioperl on linux. Could you please give me
> > > some
> > > > > > > suggestion?
> > > > > > > Thanks,
> > > > > > > Guojun
> > > > > > > > > Department of Plant Biology
> > > > > > > University of Georgia
> > > > > > > _____
> > > > > > > > > From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > > > > > To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
> > > > > > > Sent: Mon, 13 Feb 2006 11:45:14 -0500
> > > > > > > Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
> > > > > version
> > > > > > > 1.28
> > > > > > > > > > > > > If you're using RemoteBlast 1.28, then you've likely
> > > > > updated from CVS
> > > > > > > which isn't the latest fix.
> > > > > > > > > Make sure that you check the following:
> > > > > > > > > 1) Always post to the mailing list:
> > > > > > > http://www.bioperl.org/wiki/HOWTO:Beginners#Getting_Assistance .
> > > > > > > > > 2) You must have the complete bioperl-1.5.1 or bioperl-live
> > > (CVS)
> > > > > > > installed first. Perform a clean installation; do not upgrade
> > > only
> > > > > > > Bio::SearchIO::blast and Bio::Tools::Run::RemoteBlast, as we
> > can't
> > > > > > > guarantee that mixing modules from old and new distributions
> > (1.4
> > > and
> > > > > > > 1.5.1, for instance) will work. A bioperl-1.5.1 or bioperl-live
> > > > > > > installation will allow text output from BLAST v.2.2.12 to be
> > > saved
> > > > > and
> > > > > > > parsed; it will not parse the newest BLAST text output from NCBI
> > > > > (v2.2.13)
> > > > > > > but it should still save it. I believe as long as next_results()
> > > isn't
> > > > > > > called, it will work.
> > > > > > > > > 3) The bug fixes for the above issue with parsing BLAST
> > 2.2.13
> > > > > text output
> > > > > > > are NOT in CVS; they haven't been cleared and checked in by
> > Roger
> > > Hall
> > > > > > > (who's now taking care of RemoteBlast) and the powers that be
> > > (Jason
> > > > > or
> > > > > > > whomever is in charge of Bio::SearchIO). They can be found in
> > > > > Bugzilla:
> > > > > > > > > http://bugzilla.bioperl.org/show_bug.cgi?id=1934
> > > > > > > http://bugzilla.bioperl.org/show_bug.cgi?id=1935
> > > > > > > > > The fix in RemoteBlast in Bugzilla (#1935) is to allow the
> > > option
> > > > > of
> > > > > > > saving XML output, so isn't necessary if you don't plan on using
> > > this
> > > > > > > option. And, remember, they haven't been committed yet to CVS,
> > > which
> > > > > > > means that the final version will change to refle the new
> > version.
> > > > > > > > > > > Christopher Fields
> > > > > > > Postdoctoral Researcher - Switzer Lab
> > > > > > > Dept. of Biochemistry
> > > > > > > University of Illinois Urbana-Champaign
> > > > > > > > > > > _____
> > > > > > > > > > > From: Guojun Yang [mailto:gyang at plantbio.uga.edu]
> > > > > > > Sent: Monday, February 13, 2006 9:26 AM
> > > > > > > To: Chris Fields
> > > > > > > Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
> > > > > version
> > > > > > > 1.28
> > > > > > > > > > > Hi, Chris
> > > > > > > > > Thanks for your suggestion, however, it doesn't seem to work
> > > for
> > > > > my cgi
> > > > > > > even after I replace both blast.pm and RemoteBlast.pm. I didn't
> > > even
> > > > > get
> > > > > > > any RID. Is there any suggestion?
> > > > > > > > > > > > > Guojun
> > > > > > > > > > > Guojun Yang
> > > > > > > Department of Plant Biology
> > > > > > > University of Georgia
> > > > > > > Tel: 706-542-1857
> > > > > > > Fax: 706-542-1805
> > > > > > > http://www.arches.uga.edu/~guojun
> > > > > > > _____
> > > > > > > > > > > From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > > > > > To: gyang at plantbio.uga.edu, bioperl-l at bioperl.org
> > > > > > > Sent: Fri, 03 Feb 2006 16:07:29 -0500
> > > > > > > Subject: RE: [Bioperl-l] more question regarding RemoteBlast.pm
> > > > > version
> > > > > > > 1.28
> > > > > > > > > I would say give the new code a try, but realize that it
> > > hasn't
> > > > > been
> > > > > > > checked
> > > > > > > in (like I said below). I will try going over the modified
> > > > > > > Bio::SearchIO::blast again this weekend to see if there is
> > > anything I
> > > > > > > might
> > > > > > > have missed. The changed order in the header of BLAST text
> > output
> > > has
> > > > > me a
> > > > > > > bit worried that it might not catch everything, but it at least
> > > > > doesn't
> > > > > > > hang
> > > > > > > in the while() loop I described in the bug report below (bug
> > > #1934)
> > > > > and
> > > > > > > seems to process everything fine.
> > > > > > > > > If you want more stability in the code, you might consider
> > > > > changing over
> > > > > > > to
> > > > > > > XML output and parsing with Bio::SearchIO::blastxml. There are
> > > some
> > > > > > > changes
> > > > > > > in Bio::Tools::Run::RemoteBlast (bug #1935) that accommodate
> > > saving
> > > > > XML
> > > > > > > output, but I believe it parses everything regardless. If you
> > look
> > > > > back
> > > > > > > the
> > > > > > > last month or so there has been a bit of discussion here about
> > it.
> > > > > Jason
> > > > > > > describes a bit on how to set up RemoteBlast for XML:
> > > > > > > > > http://bioperl.org/news/2005/11/06/getting-blastxml-using-
> > > > > remoteblast/
> > > > > > > > > Christopher Fields
> > > > > > > Postdoctoral Researcher - Switzer Lab
> > > > > > > Dept. of Biochemistry
> > > > > > > University of Illinois Urbana-Champaign
> > > > > > > > > > -----Original Message-----
> > > > > > > > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
> > > > > > > > bounces at lists.open-bio.org] On Behalf Of Guojun Yang
> > > > > > > > Sent: Friday, February 03, 2006 1:45 PM
> > > > > > > > To: bioperl-l at bioperl.org
> > > > > > > > Subject: [Bioperl-l] more question regarding RemoteBlast.pm
> > > version
> > > > > 1.28
> > > > > > > >
> > > > > > > > Hi, Everybody,
> > > > > > > > I see this post and am wondering if this is the reason for the
> > > > > > > > malfunctionning of my webserver. We set up a webserver named
> > > MAK,
> > > > > for
> > > > > > > MITE
> > > > > > > > sequence analysis. It was working very well until around
> > > November
> > > > > 2005,
> > > > > > > > when it stopped returning any result (the site is fine and
> > seems
> > > to
> > > > > be
> > > > > > > > doing sth after submission). In the CGI script, I used
> > > remoteblast
> > > > > (that
> > > > > > > > work was done in 2003) to do searches. I currently do not have
> > > > > access to
> > > > > > > > the server because I moved. Quite several people sent emails
> > to
> > > us
> > > > > about
> > > > > > > > its malfunctioning. Is there any suggestion on fixing the
> > > problem?
> > > > > > > Should
> > > > > > > > I simplily ask the remoteblast.pm be replaced with the new
> > > version?
> > > > > > > > Thanks a lot,
> > > > > > > > Guojun
> > > > > > > >
> > > > > > > > Department of Plant Biology
> > > > > > > > University of Georgia
> > > > > > > > Tel: 706-542-1857
> > > > > > > > Fax: 706-542-1805
> > > > > > > > http://www.arches.uga.edu/~guojun
> > > > > > > > _____
> > > > > > > >
> > > > > > > > From: Chris Fields [mailto:cjfields at uiuc.edu]
> > > > > > > > To: 'Nagesh Chakka' [mailto:nagesh.chakka at anu.edu.au], 'Huang
> > > Jian'
> > > > > > > > [mailto:hjian at kuicr.kyoto-u.ac.jp], 'bioperl-l'
> > [mailto:bioperl-
> > > > > > > > l at bioperl.org]
> > > > > > > > Sent: Fri, 03 Feb 2006 10:45:23 -0500
> > > > > > > > Subject: Re: [Bioperl-l] RemoteBlast.pm version 1.28
> > > > > > > >
> > > > > > > > Like Nagesh says, try the latest RemoteBlast from bioperl-live
> > > CVS.
> > > > > It
> > > > > > > > will
> > > > > > > > work for saving text output. However, it will not parse
> > anything
> > > > > using
> > > > > > > > next_result (it will likely hang) and will not save XML
> > format.
> > > See
> > > > > > > these
> > > > > > > > bugs:
> > > > > > > >
> > > > > > > > http://bugzilla.bioperl.org/show_bug.cgi?id=1934
> > > > > > > > http://bugzilla.bioperl.org/show_bug.cgi?id=1935
> > > > > > > >
> > > > > > > > for explanations and possible fixes (changes to RemoteBlast
> > and
> > > > > > > > Bio::SearchIO::blast). Note that these haven't been checked in
> > > yet
> > > > > so
> > > > > > > are
> > > > > > > > still not included in bioperl-live; they may be further
> > modified
> > > > > before
> > > > > > > > committing to CVS. If you're not worried about XML, you could
> > > just
> > > > > try
> > > > > > > the
> > > > > > > > first fix, which is a change to SearchIO::blast.
> > > > > > > >
> > > > > > > > Nagesh, I remember you posting to the list a month ago using a
> > > > > script
> > > > > > > > which
> > > > > > > > had problems; the script you used saves the output but doesn't
> > > > > actually
> > > > > > > > parse it (i.e. you don't use next_result() to go through the
> > > data).
> > > > > Is
> > > > > > > the
> > > > > > > > version of BLAST in your text output 2.2.12 or 2.2.13? Have
> > you
> > > > > tried
> > > > > > > > parsing the output using "-readmethod => SearchIO" or "-
> > > readmethod
> > > > > =>
> > > > > > > > blast"
> > > > > > > > using your version of RemoteBlast and method next_result()?
> > Like
> > > > > below
> > > > > > > > (from
> > > > > > > > perldoc):
> > > > > > > >
> > > > > > > > while ( my @rids = $factory->each_rid ) {
> > > > > > > > foreach my $rid ( @rids ) {
> > > > > > > > my $rc = $factory->retrieve_blast($rid);
> > > > > > > > if( !ref($rc) ) {
> > > > > > > > if( $rc < 0 ) {
> > > > > > > > $factory->remove_rid($rid);
> > > > > > > > }
> > > > > > > > print STDERR "." if ( $v > 0 );
> > > > > > > > sleep 5;
> > > > > > > > } else { # parsing
> > > > > > > > starts here
> > > > > > > > my $result = $rc->next_result(); # it should hang
> > > > > > > > here
> > > > > > > > #save the output
> > > > > > > > my $filename = $result->query_name()."\.out";
> > > > > > > > $factory->save_output($filename);
> > > > > > > > $factory->remove_rid($rid);
> > > > > > > > print "\nQuery Name: ", $result->query_name(), "\n";
> > > > > > > > while ( my $hit = $result->next_hit ) {
> > > > > > > > next unless ( $v > 0);
> > > > > > > > print "\thit name is ", $hit->name, "\n";
> > > > > > > > while( my $hsp = $hit->next_hsp ) {
> > > > > > > > print "\t\tscore is ", $hsp->score, "\n";
> > > > > > > > }
> > > > > > > > }
> > > > > > > > }
> > > > > > > > }
> > > > > > > > }
> > > > > > > > }
> > > > > > > >
> > > > > > > >
> > > > > > > > My script hanged if I used next_result() in any way prior to
> > the
> > > > > fixes.
> > > > > > > I
> > > > > > > > want to see how many others are having the same issues with
> > > parsing
> > > > > > > using
> > > > > > > > the CVS version of bioperl-live.
> > > > > > > >
> > > > > > > > Christopher Fields
> > > > > > > > Postdoctoral Researcher - Switzer Lab
> > > > > > > > Dept. of Biochemistry
> > > > > > > > University of Illinois Urbana-Champaign
> > > > > > > >
> > > > > > > > > -----Original Message-----
> > > > > > > > > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-
> > l-
> > > > > > > > > bounces at lists.open-bio.org] On Behalf Of Nagesh Chakka
> > > > > > > > > Sent: Thursday, February 02, 2006 7:24 PM
> > > > > > > > > To: Huang Jian; bioperl-l
> > > > > > > > > Subject: Re: [Bioperl-l] RemoteBlast.pm version 1.28
> > > > > > > > >
> > > > > > > > > Hi Huang,
> > > > > > > > > Thanks for the message. The older version of RemoteBlast.pm
> > > works
> > > > > on
> > > > > > > the
> > > > > > > > > logic of checking the temporary file size to determine
> > whether
> > > the
> > > > > > > Blast
> > > > > > > > > results are ready. This condition is not getting satisfied
> > may
> > > be
> > > > > due
> > > > > > > to
> > > > > > > > > some changes brought about by NCBI. I had this problem
> > > recently
> > > > > and
> > > > > > > > > figured out that the solution was to use the latest version
> > > which
> > > > > has
> > > > > > > > > this problem fixed (does not use file size logic any more)
> > > which
> > > > > is
> > > > > > > not
> > > > > > > > > yet included in the BioPerl package.
> > > > > > > > > Cheers
> > > > > > > > > Nagesh
> > > > > > > > >
> > > > > > > > > Huang Jian wrote:
> > > > > > > > >
> > > > > > > > > > Dear Nagesh,
> > > > > > > > > >
> > > > > > > > > > I have replaced my old RemoteBlast.pm (v 1.17) with v 1.28
> > > you
> > > > > send
> > > > > > > > > > me. Now it works perfectly!!!
> > > > > > > > > >
> > > > > > > > > > Thank you!!
> > > > > > > > > >
> > > > > > > > > > Huang
> > > > > > > > > >
> > > > > > > > > > ----- Original Message ----- From: "Nagesh Chakka"
> > > > > > > > > > <nagesh.chakka at anu.edu.au>
> > > > > > > > > > To: "Huang Jian" <hjian at kuicr.kyoto-u.ac.jp>; "bioperl-l"
> > > > > > > > > > <bioperl-l at bioperl.org>
> > > > > > > > > > Sent: Friday, February 03, 2006 7:48 AM
> > > > > > > > > > Subject: Re: [Bioperl-l] Sorry, failure in post on the
> > net,
> > > so
> > > > > still
> > > > > > > > > > via email
> > > > > > > > > >
> > > > > > > > > >
> > > > > > > > > >> Hi Huang,
> > > > > > > > > >> I see that you are submitting a sequence for a remote
> > blast
> > > > > search.
> > > > > > > > Can
> > > > > > > > > >> you check if the RemoteBlast.pm being used is v 1.28
> > > > > (2005/12/09).
> > > > > > > If
> > > > > > > > > >> not I have attached it with this email, try to replace it
> > > with
> > > > > the
> > > > > > > > old
> > > > > > > > > >> one which has a bug.
> > > > > > > > > >> Let me know if it works.
> > > > > > > > > >> Nagesh
> > > > > > > > > >
> > > > > > > > > >
> > > > > > > > > >
> > > > > > > > >
> > > > > > > > > _______________________________________________
> > > > > > > > > Bioperl-l mailing list
> > > > > > > > > Bioperl-l at lists.open-bio.org
> > > > > > > > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > > > > > >
> > > > > > > > _______________________________________________
> > > > > > > > Bioperl-l mailing list
> > > > > > > > Bioperl-l at lists.open-bio.org
> > > > > > > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > > > > > >
> > > > > > > >
> > > > > > > >
> > > > > > > > _______________________________________________
> > > > > > > > Bioperl-l mailing list
> > > > > > > > Bioperl-l at lists.open-bio.org
> > > > > > > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > > > > > > > > > > > > > > > > > > > > > > >
> > > > > _______________________________________________
> > > > > > > Bioperl-l mailing list
> > > > > > > Bioperl-l at lists.open-bio.org
> > > > > > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > > > > >
> > > > > > > _______________________________________________
> > > > > Bioperl-l mailing list
> > > > > Bioperl-l at lists.open-bio.org
> > > > > http://lists.open-bio.org/mailman/listinfo/bioperl-l
> > > > >
> >
More information about the Bioperl-l
mailing list