[Bioperl-l] A problem when converting Genbank->GFF->png using script

[Jie Zhou]

Hi all,

I wanted to convert a genbank file into a png file, trying to show the
features presented in the genbank file in a graph. I used the following
two scripts in bioperl: "feature_draw.PLS", "genbank2gff3.PLS". And I
got some error message as follows:

-----------------------------------------------------------------
jzhou at debian:~/results/GFF$ perl genbank2gff3.PLS test
Processing file test...
Use of uninitialized value in concatenation (.) or string at
genbank2gff3.PLS line 172.
working on contig NM_005476... GFF3 saved to ./.gff
jzhou at debian:~/results/GFF$ mv .gff test.gff
jzhou at debian:~/results/GFF$ perl feature_draw.PLS test.gff >test.png
Can't use string ("Bio::DB::GFF") as a HASH ref while "strict refs" in
use at /usr/local/share/perl/5.8.4/Bio/DB/GFF.pm line 2198, <> line 4.
-----------------------------------------------------------------

I checked the gff file, it looks like this:
-----------------------------------------------------------------
##gff-version 3
##sequence-region NM_005476 1 3760
##source bp_genbank2gff3.pl
NM_005476       GenBank region  1       3760    .       .       .
ID=NM_005476
NM_005476       GenBank databank_entry  1       3760    .
+       .
ID=GenBank:databank_entry:NM_005476:1:3760;mol_type=mRNA;db_xref=taxon:9606;map=9p13.2;chromosome=9;organism=Homo+sapiens
NM_005476       GenBank gene    1       3760    .       +       .
ID=gene:GNE;db_xref=GeneID:10020,HPRD:HPRD_04825,MIM:603824;gene=GNE;note=synonyms:+NM%2C+DMRV%2C+IBM2%2C+Uae1%2C+GLCNE
NM_005476       GenBank mRNA    127     2295    .       +       .
ID=mRNA:GNE.t01;Parent=gene:GNE;gene=GNE
NM_005476       GenBank CDS     127     2295    .       +       .
Parent=mRNA:GNE.t01;protein_id=NP_005467.1;gene=GNE;note=N-acylmannosamine
.
.(omitted)
.
NM_005476       GenBank exon    127     2295    .       +       .
Parent=mRNA:GNE.t01;gene=GNE
NM_005476       GenBank polyA_signal    3722    3727    .
+       .       Parent=gene:GNE;gene=GNE
NM_005476       GenBank polyA_site      3745    3745    .
+       .       Parent=gene:GNE;gene=GNE
>NM_005476
GCTCTGCCTGCTTCGTGGCGCTTGGTTCGTCCCTCGCCCGAGGAGCGCGGTGGCGGCGTG
...(ommited)
------------------------------------------------------------------

I also checked the genbank file I input, it's a correct one. I wonder,
is the procedure right? Why does the error happen? 

Thanks very much for any help.

Regards,
Jie