[Bioperl-l] mis-match position in HSP
Jason Stajich
jason.stajich at duke.edu
Wed Nov 3 08:22:47 EST 2004
Try the seq_inds method -- it allows you to get the positions where
certain characters are matches, gaps,mismatches.
I can't remember if they are returned in sequence coordinates or HSP
coordinates, I think the latter though. You can use
Bio::Coordinate::Utils to do coordinate mapping from one system to
another based on an alignment.
-jason
On Nov 2, 2004, at 8:35 PM, Sucheta Tripathy wrote:
>
> Hi,
>
> Just a quick question, is there a method to get the mis match position
> from a blast output using Bio::Search::HSP::HSPI.
>
> For example if I have an HSP like this:
>
> 5 atgaataggatagggataggtagata 26
> ||| ||||||||||||||||||||||
> 23 atgtataggatagggataggtagata 44
>
> Then the mismatch position is 4.
>
> Thanks in advance
>
> --Sucheta
>
>
> --
> Sucheta Tripathy
> Virginia Bioinformatics Institute Phase-I
> Washington street.
> Virginia Tech.
> Blacksburg,VA 24061-0447
> phone:(540)231-8138
> Fax: (540) 231-2606
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/
More information about the Bioperl-l
mailing list