[Bioperl-l] Fetching Fasta seqs from GenBank - Help request

[Barry Moore]

Alberto-

You said, "the 'get_Stream_by_id' is returning me more than the 
'sequence per se'".  I'm not sure if this is what your asking, but I'll 
take a shot.  Since your are retrieving your two sequences in EMBL 
format, you get all the associated information that you would see if you 
downloaded that same file from the web interface.  Your sequences are 
stored by BioPerl as RichSeq objects which inherits a PrimarySeq 
objects.  So that EMBL file data is stored in the RichSeq object and the 
associated PrimarySeq object it inherited.   Of course when you save 
that locally as a fasta file, that extra information is lost.  If you 
decide you need to use that data have a look at the documentation for 
Bio::Seq::RichSeq and Bio::PrimarySeq and the SeqIO and Feature 
Annotation HOW TOs to learn more.

Barry

Alberto Davila wrote:

>Thanks Jason,
>
>I installed the IO::String, then it is working fine now. However I have
>a doubt, the "get_Stream_by_id" is returning me more than the "sequence
>per se", what is it ? My script and results are listed below. Finally I
>would like to save (in my local disk) the retrieved sequences as fasta
>files... is there any argument for that ?
>
>Thanks again, Alberto
>
>
>#!/usr/local/bin/perl -w
>
>use lib "/usr/local/bioperl14";
>use Bio::DB::BioFetch;
>use strict;
>use Bio::DB::WebDBSeqI;
>use HTTP::Request::Common 'POST';
>
>my $format_type='fasta';
>my $stream;
>
>
>my $bf = new Bio::DB::BioFetch(-format        =>$format_type,
>                               -retrievaltype =>'tempfile',
>			       -db            =>'EMBL');
>				  
> $stream = $bf->get_Stream_by_id(['BUM','J00231']);
> while (my $s = $stream->next_seq) {
>    print $s->seq,"\n\n\n";
>	}			  
>				  
> 	  
>	  exit;
>
>
>
>
>[davila at tryps script]$ perl gb-fetch-1.pl
>agtagtgtactaccaagtatagataacgtttaaatattaaagttttggatcaaagccaaagatgattcgcat
>gctggtgctgattgtagttacagctgcaagcccagtgtatcagagatgtttccaagatggggctatagtgaa
>gcaaaacccatccaaagaggcagtcacagaagtgtccctaaaagatgatgttagca
>                                                                                
>                                                                                
>cctggacctcctgtgcaagaacatgaaacanctgtggttcttccttctcctggtggcagctcccagatgggt
>cctgtcccaggtgcacctgcaggagtcgggcccaggactggggaagcctccagagctcaaaaccccacttgg
>tgacacaactcacacatgcccacggtgcccagagcccaaatcttgtgacacacctcccccgtgcccacggtg
>cccagagcccaaatcttgtgacacacctcccccatgcccacggtgcccagagcccaaatcttgtgacacacc
>tcccccgtgcccnnngtgcccagcacctgaactcttgggaggaccgtcagtcttcctcttccccccaaaacc
>caaggatacccttatgatttcccggacccctgaggtcacgtgcgtggtggtggacgtgagccacgaagaccc
>nnnngtccagttcaagtggtacgtggacggcgtggaggtgcataatgccaagacaaagctgcgggaggagca
>gtacaacagcacgttccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaacggcaaggagta
>caagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaaggacagcc
>cnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaggagatgaccaagaaccaagtcagcctgacctg
>cctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaacta
>caacaccacgcctcccatgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagag
>caggtggcagcaggggaacatcttctcatgctccgtgatgcatgaggctctgcacaaccgctacacgcagaa
>gagcctctccctgtctccgggtaaatgagtgccatggccggcaagcccccgctccccgggctctcggggtcg
>cgcgaggatgcttggcacgtaccccgtgtacatacttcccaggcacccagcatggaaataaagcacccagcg
>ctgccctgg
>
>
>
>
>On Tue, 2004-03-23 at 22:44, Jason Stajich wrote:
>  
>
>>You need an additional perl module.
>>
>>
>>install IO::String from CPAN
>>
>>There is a section on how to install additional perl modules in the
>>INSTALL document.
>>
>>-j
>>
>>On Tue, 23 Mar 2004, Alberto Davila wrote:
>>
>>    
>>
>>>Hi,
>>>
>>>May I ask for some help ?
>>>
>>>I am trying to use the BioFetch module in order to download several seqs
>>>(from specific Organisms) from GenBank in fasta format, but looks like I
>>>am missing "IO/String.pm" and other things.. should I install additional
>>>bioperl modules (I have the Bioperl Core 1.4 installed) ? or use a
>>>different module for my purpose ?
>>>
>>>My script and error msg are listed below.
>>>
>>>Thanks and besr regards,
>>>
>>>Alberto
>>>
>>>****
>>>
>>>#!/usr/local/bin/perl -w
>>>
>>>use lib "/usr/local/bioperl14";
>>>package Bio::DB::BioFetch;
>>>use strict;
>>>use Bio::DB::WebDBSeqI;
>>>use HTTP::Request::Common 'POST';
>>>
>>>my $format_type='fasta';
>>>my $stream;
>>>
>>>
>>>my $bf = new Bio::DB::BioFetch(-format        =>$format_type',
>>>                               -retrievaltype =>'tempfile',
>>>                               -db            =>'EMBL');
>>>
>>> $stream = $bf->get_Stream_by_id(['BUM','J00231']);
>>> while (my $s = $stream->next_seq) {
>>>    print $s->seq,"\n";
>>>        }
>>>
>>>
>>>          exit;
>>>
>>>
>>>[davila at tryps script]$ perl gb-fetch-1.pl
>>>Can't locate IO/String.pm in @INC (@INC contains:
>>>/usr/local/bioperl14/i386-linux-thread-multi /usr/local/bioperl14
>>>/usr/lib/perl5/5.8.3/i386-linux-thread-multi /usr/lib/perl5/5.8.3
>>>/usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>>>/usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>>>/usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>>>/usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>>>/usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
>>>/usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
>>>/usr/lib/perl5/site_perl
>>>/usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>>>/usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>>>/usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>>>/usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>>>/usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
>>>/usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
>>>/usr/lib/perl5/vendor_perl .) at
>>>/usr/local/bioperl14/Bio/DB/WebDBSeqI.pm line 90.
>>>BEGIN failed--compilation aborted at
>>>/usr/local/bioperl14/Bio/DB/WebDBSeqI.pm line 90.
>>>Compilation failed in require at gb-fetch-1.pl line 6.
>>>BEGIN failed--compilation aborted at gb-fetch-1.pl line 6.
>>>      
>>>
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l at portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>  
>

-- 
Barry Moore
Dept. of Human Genetics
University of Utah
Salt Lake City, UT