[Bioperl-l] Fetching Fasta seqs from GenBank - Help request

[Remo Sanges]

Hi Alberto,

you are getting 2 sequences because
you are querying for 2 id: BUM and J00231.
With the get stream by id method you can ask for
a large number of id, you need only write id separated by ','
in the array ref ['id1','id2','id3','id4',...].

Remo


On Mar 25, 2004, at 1:40 PM, Alberto Davila wrote:

> Thanks Jason,
>
> I installed the IO::String, then it is working fine now. However I have
> a doubt, the "get_Stream_by_id" is returning me more than the "sequence
> per se", what is it ? My script and results are listed below. Finally I
> would like to save (in my local disk) the retrieved sequences as fasta
> files... is there any argument for that ?
>
> Thanks again, Alberto
>
>
> #!/usr/local/bin/perl -w
>
> use lib "/usr/local/bioperl14";
> use Bio::DB::BioFetch;
> use strict;
> use Bio::DB::WebDBSeqI;
> use HTTP::Request::Common 'POST';
>
> my $format_type='fasta';
> my $stream;
>
>
> my $bf = new Bio::DB::BioFetch(-format        =>$format_type,
>                                -retrievaltype =>'tempfile',
> 			       -db            =>'EMBL');
> 				
>  $stream = $bf->get_Stream_by_id(['BUM','J00231']);
>  while (my $s = $stream->next_seq) {
>     print $s->seq,"\n\n\n";
> 	}			
> 				
>  	
> 	  exit;
>
>
>
>
> [davila at tryps script]$ perl gb-fetch-1.pl
> agtagtgtactaccaagtatagataacgtttaaatattaaagttttggatcaaagccaaagatgattcgca 
> t
> gctggtgctgattgtagttacagctgcaagcccagtgtatcagagatgtttccaagatggggctatagtga 
> a
> gcaaaacccatccaaagaggcagtcacagaagtgtccctaaaagatgatgttagca
>
>
> cctggacctcctgtgcaagaacatgaaacanctgtggttcttccttctcctggtggcagctcccagatggg 
> t
> cctgtcccaggtgcacctgcaggagtcgggcccaggactggggaagcctccagagctcaaaaccccacttg 
> g
> tgacacaactcacacatgcccacggtgcccagagcccaaatcttgtgacacacctcccccgtgcccacggt 
> g
> cccagagcccaaatcttgtgacacacctcccccatgcccacggtgcccagagcccaaatcttgtgacacac 
> c
> tcccccgtgcccnnngtgcccagcacctgaactcttgggaggaccgtcagtcttcctcttccccccaaaac 
> c
> caaggatacccttatgatttcccggacccctgaggtcacgtgcgtggtggtggacgtgagccacgaagacc 
> c
> nnnngtccagttcaagtggtacgtggacggcgtggaggtgcataatgccaagacaaagctgcgggaggagc 
> a
> gtacaacagcacgttccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaacggcaaggagt 
> a
> caagtgcaaggtctccaacaaagccctcccagcccccatcgagaaaaccatctccaaagccaaaggacagc 
> c
> cnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaggagatgaccaagaaccaagtcagcctgacct 
> g
> cctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaact 
> a
> caacaccacgcctcccatgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaaga 
> g
> caggtggcagcaggggaacatcttctcatgctccgtgatgcatgaggctctgcacaaccgctacacgcaga 
> a
> gagcctctccctgtctccgggtaaatgagtgccatggccggcaagcccccgctccccgggctctcggggtc 
> g
> cgcgaggatgcttggcacgtaccccgtgtacatacttcccaggcacccagcatggaaataaagcacccagc 
> g
> ctgccctgg
>
>
>
>
> On Tue, 2004-03-23 at 22:44, Jason Stajich wrote:
>> You need an additional perl module.
>>
>>
>> install IO::String from CPAN
>>
>> There is a section on how to install additional perl modules in the
>> INSTALL document.
>>
>> -j
>>
>> On Tue, 23 Mar 2004, Alberto Davila wrote:
>>
>>> Hi,
>>>
>>> May I ask for some help ?
>>>
>>> I am trying to use the BioFetch module in order to download several  
>>> seqs
>>> (from specific Organisms) from GenBank in fasta format, but looks  
>>> like I
>>> am missing "IO/String.pm" and other things.. should I install  
>>> additional
>>> bioperl modules (I have the Bioperl Core 1.4 installed) ? or use a
>>> different module for my purpose ?
>>>
>>> My script and error msg are listed below.
>>>
>>> Thanks and besr regards,
>>>
>>> Alberto
>>>
>>> ****
>>>
>>> #!/usr/local/bin/perl -w
>>>
>>> use lib "/usr/local/bioperl14";
>>> package Bio::DB::BioFetch;
>>> use strict;
>>> use Bio::DB::WebDBSeqI;
>>> use HTTP::Request::Common 'POST';
>>>
>>> my $format_type='fasta';
>>> my $stream;
>>>
>>>
>>> my $bf = new Bio::DB::BioFetch(-format        =>$format_type',
>>>                                -retrievaltype =>'tempfile',
>>>                                -db            =>'EMBL');
>>>
>>>  $stream = $bf->get_Stream_by_id(['BUM','J00231']);
>>>  while (my $s = $stream->next_seq) {
>>>     print $s->seq,"\n";
>>>         }
>>>
>>>
>>>           exit;
>>>
>>>
>>> [davila at tryps script]$ perl gb-fetch-1.pl
>>> Can't locate IO/String.pm in @INC (@INC contains:
>>> /usr/local/bioperl14/i386-linux-thread-multi /usr/local/bioperl14
>>> /usr/lib/perl5/5.8.3/i386-linux-thread-multi /usr/lib/perl5/5.8.3
>>> /usr/lib/perl5/site_perl/5.8.3/i386-linux-thread-multi
>>> /usr/lib/perl5/site_perl/5.8.2/i386-linux-thread-multi
>>> /usr/lib/perl5/site_perl/5.8.1/i386-linux-thread-multi
>>> /usr/lib/perl5/site_perl/5.8.0/i386-linux-thread-multi
>>> /usr/lib/perl5/site_perl/5.8.3 /usr/lib/perl5/site_perl/5.8.2
>>> /usr/lib/perl5/site_perl/5.8.1 /usr/lib/perl5/site_perl/5.8.0
>>> /usr/lib/perl5/site_perl
>>> /usr/lib/perl5/vendor_perl/5.8.3/i386-linux-thread-multi
>>> /usr/lib/perl5/vendor_perl/5.8.2/i386-linux-thread-multi
>>> /usr/lib/perl5/vendor_perl/5.8.1/i386-linux-thread-multi
>>> /usr/lib/perl5/vendor_perl/5.8.0/i386-linux-thread-multi
>>> /usr/lib/perl5/vendor_perl/5.8.3 /usr/lib/perl5/vendor_perl/5.8.2
>>> /usr/lib/perl5/vendor_perl/5.8.1 /usr/lib/perl5/vendor_perl/5.8.0
>>> /usr/lib/perl5/vendor_perl .) at
>>> /usr/local/bioperl14/Bio/DB/WebDBSeqI.pm line 90.
>>> BEGIN failed--compilation aborted at
>>> /usr/local/bioperl14/Bio/DB/WebDBSeqI.pm line 90.
>>> Compilation failed in require at gb-fetch-1.pl line 6.
>>> BEGIN failed--compilation aborted at gb-fetch-1.pl line 6.
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>