[Bioperl-l] Difference between

[Wiepert, Mathieu]

Hi,

I have a vague recollection of this problem, so this answer is likely wrong, but I think it has something to do with the filtered sequence?  You have 9 masked NT's, so it is probably a difference in the defaults, and something to do with the XML output not masked?

Sorry I can't find the emails I had with NCBI on this, but I am maybe 70% sure that it is a problem like that, with defaults on the local server versus NCBI, and the XML not using masked data?

Someone else chime in if I am way off there...

HTH,

-mat

> -----Original Message-----
> From: bioperl-l-bounces at portal.open-bio.org
> [mailto:bioperl-l-bounces at portal.open-bio.org]On Behalf Of tai kwan do
> Sent: Friday, January 30, 2004 2:06 AM
> To: bioperl-l at bioperl.org
> Subject: [Bioperl-l] Difference between 
> 
> 
> Hello,
> 
> Maybe someone could help me out with this problem, I've tried 
> to email ncbi 
> about this but they didn't bother answering.  Basically, I'm seeing a 
> difference in the data being output by stand-alone blast and 
> online blast.  
> The identities value are different between the xml output and 
> the pairwise 
> alignment output, even though I'm using the exact same input 
> values.  The 
> other difference I see is in the query and hit sequences.  
> I've included 
> below the outputs using the same input parameters, is this 
> normal behavior?
> 
>    gb|AE000111.1|AE000111 Escherichia coli K-12 MG1655 
> section 1 of 400 of 
> the complete
> 
>          genome
>         Length = 10596
> 
> Score =  589 bits (297), Expect = e-168
> Identities = 315/324 (97%)
> Strand = Plus / Plus
> 
> 
> Query: 237 
> aggtaacggtgcgggctgacgcgtacaggaaacacagaaaaaagcccgcacctgacagtg 296
>          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 237 
> aggtaacggtgcgggctgacgcgtacaggaaacacagaaaaaagcccgcacctgacagtg 296
> 
> 
> Query: 297 
> cgggcnnnnnnnnncgaccaaaggtaacgaggtaacaaccatgcgagtgttgaagttcgg 356
>          |||||         ||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 297 
> cgggctttttttttcgaccaaaggtaacgaggtaacaaccatgcgagtgttgaagttcgg 356
> 
> 
> Query: 357 
> cggtacatcagtggcaaatgcagaacgttttctgcgtgttgccgatattctggaaagcaa 416
>          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 357 
> cggtacatcagtggcaaatgcagaacgttttctgcgtgttgccgatattctggaaagcaa 416
> 
> 
> Query: 417 
> tgccaggcaggggcaggtggccaccgtcctctctgcccccgccaaaatcaccaaccacct 476
>          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 417 
> tgccaggcaggggcaggtggccaccgtcctctctgcccccgccaaaatcaccaaccacct 476
> 
> 
> Query: 477 
> ggtggcgatgattgaaaaaaccattagcggccaggatgctttacccaatatcagcgatgc 536
>          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 477 
> ggtggcgatgattgaaaaaaccattagcggccaggatgctttacccaatatcagcgatgc 536
> 
> 
> Query: 537 cgaacgtatttttgccgaactttt 560
>          ||||||||||||||||||||||||
> Sbjct: 537 cgaacgtatttttgccgaactttt 560
> 
> 
>       <Hit>
>         <Hit_num>1</Hit_num>
>         <Hit_id>gi|1786181|gb|AE000111.1|AE000111</Hit_id>
>         <Hit_def>Escherichia coli K-12 MG1655 section 1 of 400 of the 
> complete genome</Hit_def>
>         <Hit_accession>AE000111</Hit_accession>
>         <Hit_len>10596</Hit_len>
>         <Hit_hsps>
>           <Hsp>
>             <Hsp_num>1</Hsp_num>
>             <Hsp_bit-score>589.253</Hsp_bit-score>
>             <Hsp_score>297</Hsp_score>
>             <Hsp_evalue>1.04898e-168</Hsp_evalue>
>             <Hsp_query-from>237</Hsp_query-from>
>             <Hsp_query-to>560</Hsp_query-to>
>             <Hsp_hit-from>237</Hsp_hit-from>
>             <Hsp_hit-to>560</Hsp_hit-to>
>             <Hsp_query-frame>1</Hsp_query-frame>
>             <Hsp_hit-frame>1</Hsp_hit-frame>
>             <Hsp_identity>324</Hsp_identity>
>             <Hsp_positive>324</Hsp_positive>
>             <Hsp_align-len>324</Hsp_align-len>
>             
> <Hsp_qseq>AGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACC
> TGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA
> GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAA
> GCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCAC
> CTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGC
> CGAACGTATTTTTGCCGAACTTTT</Hsp_qseq>
>             
> <Hsp_hseq>AGGTAACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACC
> TGACAGTGCGGGCTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAA
> GTTCGGCGGTACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAA
> GCAATGCCAGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCAC
> CTGGTGGCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGC
> CGAACGTATTTTTGCCGAACTTTT</Hsp_hseq>
>             
> <Hsp_midline>|||||||||||||||||||||||||||||||||||||||||||||||||
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> |||||||||||||||||||||||||||</Hsp_midline>
>           </Hsp>
>           <Hsp>
> 
> Thanks in advance
> 
> _________________________________________________________________
> High-speed users-be more efficient online with the new MSN 
> Premium Internet 
> Software. http://join.msn.com/?pgmarket=en-us&page=byoa/prem&ST=1
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>