[Bioperl-l] RemoteBlast again

[Jason Stajich]

why do you have -format => 'fasta' commented out - you want this to be
provided to the seqio parser.

On Mon, 26 Jan 2004, [iso-8859-1] william ritchie wrote:

> Sorry about the incomplete question, I was leaving and
> I wondered if this was a common error. This is the
> code that gives my previous error message....
>
>  use strict;
> use Bio::SearchIO;
> use Bio::Tools::Run::RemoteBlast;
> use Bio::Perl;
> use Bio::SeqIO;
>
>
>     my @inputfiles = @ARGV;
>
>     foreach my $inputfile (@inputfiles)
>
> {
>
>          my $prog = 'blastn';
>          #my $db   = 'gbEST';
>          my $e_val= '1e-10';
>
>
>          my @params = ( '-prog' => $prog,
>                 ' -data  '=> 'est_mouse',
>                 ' -expect'  => $e_val,
>                 ' -readmethod'  => ' SearchIO'  );
>
>
>          my $factory =
> Bio::Tools::Run::RemoteBlast->new(@params);
>
>
>                           my $v = 1;
>
>
>          my $str = Bio::SeqIO->new(
> 		        -file=>
> "/home/billthebrute/Projet/endogpcr/"."$inputfile",
> 		      #  -format  => ' Fasta'
> 				  );
>
>
> $Bio::Tools::Run::RemoteBlast::HEADER{'DATABASE'} =
> 'est_mouse';
>
> $Bio::Tools::Run::RemoteBlast::HEADER{'PROGRAM'} =
> 'blastn';
>
>          while (my $input = $str->next_seq())
>              {
>
>
>           my $r = $factory->submit_blast($input);
>
>
> 	  print STDERR "waiting..." if( $v > 0 );
>
>            while ( my @rids = $factory->each_rid ) {
>              foreach my $rid ( @rids ) {
>                my $rc =
> $factory->retrieve_blast($rid);
>                if( !ref($rc) ) {
>                  if( $rc < 0 ) {
>                    $factory->remove_rid($rid);
>                  }
>                  print STDERR "." if ( $v > 0 );
>                  sleep 5 ;
>                } else {
>                  my $result = $rc->next_result();
>                  #save the output
>                  #my $filename =
> $result->query_name()."\.out";
> 		 print "$inputfile";
>
> $factory->save_output("/home/billthebrute/Projet/blasted/"."$inputfile");
>                  $factory->remove_rid($rid);
>
>
>
>                }
>              }
>            }
>           }
> }
>
>
>
> I m recieving this error message:
> ----------------- WARNING ---------------------
> MSG: seq doesn't validate, mismatch is 1
> ---------------------------------------------------
>
> ------------- EXCEPTION  -------------
> MSG: Attempting to set the sequence to
> [ADRA2ANM_007417ATGGGCTCACTGCAGCCGGATGCCGGCAACAGCAGCTGGAACGGGACCGAAGCGCCCGGAGGCGGC
>
> With the attached file!
> Thanks
>
> _________________________________________________________________
> Do You Yahoo!? -- Une adresse @yahoo.fr gratuite et en français !
> Yahoo! Mail : http://fr.mail.yahoo.com

--
Jason Stajich
Duke University
jason at cgt.mc.duke.edu