[Bioperl-l] AlignIO warning

[Alexandre Irrthum]

Hi there,

The snippet of code shown below works fine (with bioperl 1.4), but it
issues this warning when next_aln() is called:


-------------------- WARNING ---------------------
MSG: Must provide which type of BLAST was run (blastp,blastn, tblastn,
tblastx, blastx) if you want strand information to get set properly for
DNA query or subjects



#!/usr/bin/perl
 
use warnings;
use strict;
use Bio::Seq;
use Bio::Tools::Run::StandAloneBlast;
use Bio::AlignIO;
 
my $seq1 = Bio::Seq->new(-display_id => 'Sequence1', -seq =>
'AGGATAGGGCGGATAGGTAGCGCCGATTTACGCGATACGCG');
my $seq2 = Bio::Seq->new(-display_id => 'Sequence2', -seq =>
'AGGATAGGGCAGATAGGTAGCGCCGATTTACGTGATACGCG');
my $factory = Bio::Tools::Run::StandAloneBlast->new(program => 'blastn',
outfile => 'bl2seq.out');
$factory->bl2seq($seq1, $seq2);
my $str = Bio::AlignIO->new(-file => 'bl2seq.out', -format => 'bl2seq');
my $aln = $str->next_aln(); ###### Warning issued here ######
foreach my $seq ($aln->each_seq()) {
    print $seq->seq(), "\n";
}

How am I supposed to provide program name ?

Thank you for your help.

Alex