[Bioperl-l] Problems running blast

[Barry Moore]

Hong-

You don't have to make your sequence into a fasta file.  Have a look at 
the documentation for the submit_blast method of the 
Bio::Tools::Run::RemoteBlast module where it tells you that the input 
can be a sequence object, a reference to an array of sequence objects, 
or the filename of a fasta file.  If your script already has your 
sequence as any of the Bioperl sequence objects, then you are ready to 
go.  If your script has your sequence as a simple string, it is quite 
easy to convert that to a PrimarySeq object which you can then submit to 
BLAST.  The following script (adapted from the module documentation) 
suggests one way of converting a string to a PrimaySeq object and 
submitting it to BLAST.  See the example code in the Synopsis section of 
the RemoteBlast module documentation mentioned above for examples of how 
to submit a sequence object, or a fasta file to BLAST.

Barry

----------------------------------------------------------------------------------------------

#!/usr/bin/perl
use strict;
use warnings;
use Bio::PrimarySeq;
use Bio::Tools::Run::RemoteBlast;

#Your sequence as a string
my $sequence_string = 
"atggagagcagaggcccactggctacctcgcgcctgctgctgttgctgctgttgctacta";

#Initialize string as new sequence
my $seq = new Bio::PrimarySeq(-seq         => $sequence_string,
                              -display_id  => "Your_favorite_gene");

#Build the BLAST factory
my $BLAST_factory = Bio::Tools::Run::RemoteBlast->new('-prog'       => 
'blastn',
                                                      '-data'       => 'nr',
                                                      '-expect'     => .001,
                                                      '-readmethod' => 
'SearchIO' );
#Submit the sequence object to NCBI's BLAST server
my $job = $BLAST_factory->submit_blast($seq);
print STDERR "Blasting sequence ";
#Load the RIDs returned for the BLAST job submitted (in this case only one)
while ( my @rids = $BLAST_factory->each_rid ) {
  #Iterate over RIDs
  foreach my $rid ( @rids ) {
    #Hit the server for a result on RID
    my $blast_results = $BLAST_factory->retrieve_blast($rid);
    #Was a result returned?
    if( !ref($blast_results) ) {
      #If so and it returned an error remove that RID from the stack
      if ($blast_results < 0) {
        $BLAST_factory->remove_rid($rid);
      }
      print STDERR "."; #Keep staring at the dots
      sleep 5; #Plays nice with the servers
    }
    #If a result was returned and it isn't an error, then pass it to a 
variable...
    else {
      my $result = $blast_results->next_result();
      $BLAST_factory->remove_rid($rid); #...and remove it's RID from the 
stack.
      #Check the result for a hit...
      my $hit = $result->next_hit;
      if (ref($hit)) {
        my $hsp = $hit->next_hsp;
        #...collect some values from the result, hit and hsp objects and do
        #something with them.
        my $q_name = $result->query_name();
        my $h_name = $hit->name;
        my $evalue = $hsp->evalue();
        print "\nQuery name:  $q_name\nHit name:  $h_name\nLowest 
e-value:  $evalue\n";
      }
    }
  }
}



Hong Ching Lee wrote:

>Hey everyone,
>
>I have a question about whether i can run remote blast using just a string
>or whether i have to make it into a fasta format file. Can anyone help me
>with this?
>
>Thank You,
>Hong
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l at portal.open-bio.org
>http://portal.open-bio.org/mailman/listinfo/bioperl-l
>