[Bioperl-l] matching miRNAs to one or a lot of mRNAs

[Ian Korf]

The human HES1 8400709 is not the sequence from the paper I don't 
think. If you align the sequence in figure 1a against 8400709, you'll 
find they don't match. There are other HES1 sequences in GenBank 
though, for example, 1655593, that contain the sequence in the figure. 
But if you try aligning the miRNA to 1655593 with NCBI-BLAST, you won't 
find anything.

If you do a S-W alignment (match +1, mismatch -1, gap -2) of the miRNA 
complement against 1655593 you get the following, which is the same 
alignment reported in the paper.

Stats: score=12
Alignment: Q:855..874 S:1..21 17/3 1,0
Q: TGGAACTCACTGG-AAAGTGA
    ||||| || |||| || ||||
S: TGGAAATCCCTGGAAATGTGA

You'll note that the largest ungapped alilgnment is 5nt. The authors 
did not say they used BLAST, only that they searched GenBank. 5nt is 
too short for NCBI-BLAST, which has a minimum word size of 7. WU-BLAST 
has no limit of word size, and you can find the alignment with 
WU-BLAST. Same scoring system as above used here but note that E2 had 
to be raised to at least 11 or the alignment would get pruned before 
subjected to gapped statistics. Here it is:

  Score = 12 (17.3 bits), Expect = 0.037, P = 0.037
  Identities = 17/21 (80%), Positives = 17/21 (80%), Strand = Plus / Plus

Query:   855 TGGAACTCACTGGAAA-GTGA 874
              ||||| || |||| || ||||
Sbjct:     1 TGGAAATCCCTGGCAATGTGA 21

If you make a habit of such searches, don't be surprised if you run in 
to a lot of false-positives. I think you might want to use additional 
criteria such as overlapping the stop or located in the 3'UTR. I'm not 
aware of any software specifically designed for such searches, but 
perhaps the authors of the paper have one. The paper was very brief and 
had no description of the bioinformatics in the methods section (if I 
was one of the referees, I would have found this unacceptable). I 
suggest you contact the authors and find out specifically what they did.

-Ian


On Friday, September 26, 2003, at 07:29 PM, Starr Hazard wrote:

> Folks,
>
> In a recent paper, Kawasacki et al(pubmed 12808467) report on the 
> interaction between a specific miRNA (human miRNA23 g.i. 17646028) and 
> a specific mRNA (human HES1 g.i. 8400709). They suggest they did a 
> BLAST search and ultimately located the interaction. I cannot 
> duplicate their data mining and cannot find the association they 
> describe.
>
> In general, is there a way to take a library of miRNAs and evaluate 
> their potential interaction with a particular mRNA? Or is there a data 
> mining tool that could screen a large pool of mRNAs for
> significant interactions with a pool miRNAs?
>
> I cannot at present see any BioPerl tools that address this issue 
> (right now that means I scanned the FAQ for the string RNA and 
> searched the BioPerl site for RNA but found only some traffic about 
> Seq.pm).The people I have asked seem divided about whether this is
> text matching issue or more of a hybridization issue involving
> an energy of interaction evaluation.
>
> Anybody got any pointers to offer?
>
> Starr
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>