[Bioperl-l] New modules

[Rob Edwards]

On Sunday, October 19, 2003, at 01:01  AM, Brian Osborne wrote:

> Rob,
>
> Can the repeats overlap? There was a recent feature request for 
> something
> like this...
>
> Brian O.
>
>


Yep, the repeats can and do overlap. I suppose I could add something to 
not allow this, but I haven't yet.

there is a known "issue" that if you have repeats like this

GGAAAAAAAGG  and CCAAAAAAATTAAAAAAACC

and ask it to merge the nearby repeats the left half will have length 7 
and the right half will have length 16. I just keep forgetting to add 
something to make sure the left and right halves of the repeats are the 
same length. (Note: this is only with merged repeats; if you don't 
merge things together you'll get two separate repeats).

The most recent queries I remember about repeats had to do with 
repeatmasking sequences. I haven't given this much thought but I don't 
see why you couldn't use this module for that, but I'd set the minimum 
lengths of the repeats to be quite long to start with otherwise it will 
be horribly slow. The speed is really determined by the length of the 
sequence and the length of the repeats (obviously-a short sequence will 
have fewer repeats, and longer repeats will occur less frequently).

What was the other request ? I couldn't find anything in a search 
through the mailing archive.

Rob