[Bioperl-l] New modules
Rob Edwards
redwards at utmem.edu
Sun Oct 19 14:25:05 EDT 2003
On Sunday, October 19, 2003, at 01:01 AM, Brian Osborne wrote:
> Rob,
>
> Can the repeats overlap? There was a recent feature request for
> something
> like this...
>
> Brian O.
>
>
Yep, the repeats can and do overlap. I suppose I could add something to
not allow this, but I haven't yet.
there is a known "issue" that if you have repeats like this
GGAAAAAAAGG and CCAAAAAAATTAAAAAAACC
and ask it to merge the nearby repeats the left half will have length 7
and the right half will have length 16. I just keep forgetting to add
something to make sure the left and right halves of the repeats are the
same length. (Note: this is only with merged repeats; if you don't
merge things together you'll get two separate repeats).
The most recent queries I remember about repeats had to do with
repeatmasking sequences. I haven't given this much thought but I don't
see why you couldn't use this module for that, but I'd set the minimum
lengths of the repeats to be quite long to start with otherwise it will
be horribly slow. The speed is really determined by the length of the
sequence and the length of the repeats (obviously-a short sequence will
have fewer repeats, and longer repeats will occur less frequently).
What was the other request ? I couldn't find anything in a search
through the mailing archive.
Rob
More information about the Bioperl-l
mailing list