[Bioperl-l] Using Bioperl BLAST with a cgi script

[boileau@essi.fr]

Thanks to you (and everyone else who answered ;) ), this worked perfectly
well :)
> Because your environment variables are different when running under a
> webserver than when under your user account.
> You can do this is in your code
>
> BEGIN {
> 	$ENV{PATH} .= ":/path/to/your/blastall/directory";
> }
> Or with more recent versions of bioperl
> $factory->executable('/path/to/your/blastall/exe');
>
> Note that the PATH should include the DIRECTORY where blastall is
> installed while the executable should include the full pat to where the
> EXECUTABLE is installed.
>
>
>
> On Fri, 10 Jan 2003 boileau@essi.fr wrote:
>
>> Hi, i'm kind of new to Bioperl (and Perl also), but maybe someone out
>> there will be able to answer my question. I have a script that does a
>> blast. It works well when i use it as a simply script, but when I try
>> to call as a cgi, it doesn't. The web server error message is "cannot
>> find path to blastall".Below is the code of the script.
>> Thanks to anyone who will be able to help me!
>>
>> William Boileau
>>
>>
>> -- SCRIPT SOURCE --
>>
>> $table_cible = "Homo_sapiens.cdna.fa";
>> $sequence_cible =
>> 'GGCCCCTGCCAGGGCCCTGCTACATGCGAGCACTGTCCCCCAGGCCTGGGTACCAGTCCTCCTGGGCATCGAGGCCCATCTCCACAGCAGAGTATGCCCTCCTCTACCACACCCTGCAGGAAGCCACCAAGCCCCTGCATCAGTTCTTCCT';@params>> = ('database' => $table_cible, 'outfile' => 'blast.out', 'program' =>
>> 'blastn', 'b' => 1, '_READMETHOD'=>'Blast');
>> $factory = Bio::Tools::Run::StandAloneBlast->new(@params);
>>
>> $input = Bio::Seq->new(-id=>"test query", -seq => $sequence_cible);
>> $blast_report = $factory->blastall($input);
>>
>> $searchio = new Bio::SearchIO ('-format' => 'blast','-file' =>
>> 'blast.out');
>>
>> $result = $searchio->next_result;
>> @statnames = $result->available_statistics;
>>
>>
>>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l@bioperl.org
>> http://bioperl.org/mailman/listinfo/bioperl-l
>>
>
> --
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@bioperl.org
> http://bioperl.org/mailman/listinfo/bioperl-l