[Bioperl-l] Using Bioperl BLAST with a cgi script

[James Wasmuth]

This is more likely to be an issue with the CGI rather than perl.  Is 
the CGI-BIN on the same computer as Blast?  If not that could be the 
problem, and you'll have to provide the path.  I don't remember making 
any changes to the Blast part of my script from command line to CGI, 
though I experienced many more elsewhere...  :o(

J

boileau@essi.fr wrote:

>Hi, i'm kind of new to Bioperl (and Perl also), but maybe someone out
>there will be able to answer my question. I have a script that does a
>blast. It works well when i use it as a simply script, but when I try to
>call as a cgi, it doesn't. The web server error message is "cannot find
>path to blastall".Below is the code of the script.
>Thanks to anyone who will be able to help me!
>
>William Boileau
>
>
>-- SCRIPT SOURCE --
>
>$table_cible = "Homo_sapiens.cdna.fa";
>$sequence_cible =
>'GGCCCCTGCCAGGGCCCTGCTACATGCGAGCACTGTCCCCCAGGCCTGGGTACCAGTCCTCCTGGGCATCGAGGCCCATCTCCACAGCAGAGTATGCCCTCCTCTACCACACCCTGCAGGAAGCCACCAAGCCCCTGCATCAGTTCTTCCT';@params = ('database' => $table_cible, 'outfile' => 'blast.out',
>'program' => 'blastn', 'b' => 1, '_READMETHOD'=>'Blast');
>$factory = Bio::Tools::Run::StandAloneBlast->new(@params);
>
>$input = Bio::Seq->new(-id=>"test query", -seq => $sequence_cible);
>$blast_report = $factory->blastall($input);
>
>$searchio = new Bio::SearchIO ('-format' => 'blast','-file' =>
>'blast.out');
>
>$result = $searchio->next_result;
>@statnames = $result->available_statistics;
>
>
>
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@bioperl.org
>http://bioperl.org/mailman/listinfo/bioperl-l
>  
>

-- 

Nematode Bioinformatics
Blaxter Nematode Genomics Group
Institute of Cell, Animal and Population Biology
Ashworth Labs
University of Edinburgh
King's Buildings
Edinburgh
EH9 3JT

0131 650 7403