[Bioperl-l] counting nucleotides in a sequence

[Brian Osborne]

Parvesh,

Like this:

%perl -e '$str = "gatcgggtttaaggccctttt"; (@arr) = $str =~ /.{1,10}/g; 
print "@arr";'

Remove \n from the sequence before you do the pattern match.

Brian O.



On Wednesday, February 19, 2003, at 07:49 AM, <parvesh at pacific.net.sg> 
wrote:

> Hello
> I am interested in calculating the nucleotides A,C, G and T
> in my sequence for every 10 nt window.
> So I need to write a code that will scan the sequence for every 10 nts 
> like 1-10,11-20.
> preferably i can then stack the result in arrays and write this array 
> to file.
> Can someone help me to do this using bioperl code please ?
> Thanks in advance for your help!
>
> Best wishes
> Parvesh
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at bioperl.org
> http://bioperl.org/mailman/listinfo/bioperl-l
>