[Bioperl-l] Problems loading scf files

[Brad Powers]

I am trying to deal with SCF files exported using MegaBACE Sequence
Analyzer Version 3.0 (Pro).  Whenever I try to load sequence from the
SCF I get:


-------------------- WARNING ---------------------
MSG: seq doesn't validate, mismatch is 1
---------------------------------------------------

------------- EXCEPTION  -------------
MSG: Attempting to set the sequence to
[ACGTTTCTAAGTGGATCTTCGGTCTCCGCGGGCCGGTAGTTTGCGCTTCTGCAGAGAAACCAGCGCGTTNTATI1P²Õ,"ÿáäò8F¨¢·àîSãY¯YTŽÛ¨UYÞ47ø@î,í§YÍ(2"85	
Vø¨] which does not look healthy
STACK Bio::PrimarySeq::seq
/usr/lib/perl5/site_perl/5.6.1/Bio/PrimarySeq.pm:264
STACK Bio::PrimarySeq::new
/usr/lib/perl5/site_perl/5.6.1/Bio/PrimarySeq.pm:214
STACK Bio::Seq::SeqWithQuality::new
/usr/lib/perl5/site_perl/5.6.1/Bio/Seq/SeqWithQuality.pm:214
STACK Bio::Seq::SeqFactory::create
/usr/lib/perl5/site_perl/5.6.1/Bio/Seq/SeqFactory.pm:126
STACK Bio::SeqIO::scf::next_seq
/usr/lib/perl5/site_perl/5.6.1/Bio/SeqIO/scf.pm:195
STACK toplevel ./readscf.pl:14

--------------------------------------


The code that I am using is:

================ Begin code
#!/usr/bin/perl

use Bio::Seq;
use Bio::SeqIO;

$testseq = Bio::SeqIO->new ('-format' => 'SCF',
                            '-file' => 'test.scf'
                           );

$fastaseq = Bio::SeqIO->new ('-format' => 'Fasta',
                             '-file' => '>testfasta.scf'
                            );

while ($s = $testseq->next_seq() )
   {
        print ( "sequence is ", $s->seq(), "\n");
        $result = $fastaseq->write_seq($s);
   }

=================End code

I would appreciate any help anyone could give me on this.  Thanks, Brad.