[Bioperl-l] Sequence qual values

[Brian Desany]

Hi Charles,

For generating trim data, I use "lucy" from TIGR, as it's a lot faster than
any manual perl solution I've come up with.

It has a pretty flexible trimming algorithm, although I can't guarantee that
it can do literally what you ask.

http://www.tigr.org/software/#sf

As for performing the actual trimming, it comes with an awk script to
perform the trimming for you. From a bioperl standpoint I don't know if
there's a good general purpose way to provide trim coordinate and a seq/qual
pair and get a trimmed seq/qual pair out the other end.

-Brian.


>Hi,
>
>As part of an EST project, I would like to trim sequences
>based on their
>qual values .
>
>
>Using a window size that is 10% sequence length, I want to progress
>along the seq (incrementing the window by 1 nt w/each round) and
>calculate the mean qual for the window.
>
>With the mean qual data I want to trim the 5' and 3' sequences whose
>qual values are below a cutoff value (window qual >= 20).
>
>So, in the case below, I would trim the seq to windows 3 <-> 6.
>
>			|........................|
>
>qual:	5	12	30	36	59	21	8	6
>
>window:	1	2	3	4	5	6
>7	8
>
>
>
>Data Formats: (separate files)
>
>Qual data:
>
>>1112026H03.x1 PHD_FILE: 1112026H03.x1.phd.1
>8 8 8 8 8 6 6 6 6 6 8 8 8 11 19 12 10 10 11 11 12 12
>
>
>Seq data format (fasta):
>
>>1112026H03.x1  CHROMAT_FILE: 1112026H03.x1 PHD_FILE:
>1112026H03.x1.phd.1 CHEM:
>GTCTGCTGAACTACACTACGGTCGAAGGGGAACGGGCCCCCACTCGACAT
>
>Looking through the doc's I see there is a module for reading qual
>values (Bio::Seq::PrimaryQual;).
>
>Before diving in, I thought I would check if anyone else has done
>something similar, and if so what their approach has been.
>
>
>regards,
>
>Charles
>
>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@bioperl.org
>http://bioperl.org/mailman/listinfo/bioperl-l
>