[Bioperl-l] recovering blast query_name

[Lewis Lukens]

Mat,

Thanks for the reply. I transcribed the synopsis code from the newest 
remoteblast and updated to 1.0.2 from 1.0.

I am having the same problem, however...
print "db is ", $result->database_name(),"\n";  is OK.
$result->query_name();
$result->query_description();  are empty.

I don't think anything is wrong with the input file.  I cut and 
pasted a sequence manually, and NCBI likes it.  Also, when I use 
remoteblast, it smoothly processes one sequence after the other- it 
faithfully records everything... but (seemingly) loses the query name.

None of the following query names were recorded:
>  Sequence 1
>U20499_EXON_1A 2848-2960 of U20499
>gi|22136|emb|X01965.1|ZMADH2NR (the real one)

Thanks again... other ideas?
Lewis

>Sorry for all the posts :-| latest RemoteBlast has moved to 
>bioperl-run, not bioperl-live...
>
>http://doc.bioperl.org/bioperl-run/
>
>
>-Mat
>
>Mathieu Wiepert
>Medical Informatics Research
>Mayo Foundation
>(507) 266-2317 Fax (507)-284-0360
>wiepert.mathieu@mayo.edu
>
>>  -----Original Message-----
>>  From: Wiepert, Mathieu
>>  Sent: Wednesday, November 20, 2002 3:51 PM
>>  To: 'Lewis Lukens'; bioperl-l@bioperl.org
>>  Subject: RE: [Bioperl-l] recovering blast query_name
>>
>>
>>  Hi,
>>
>>  I made a few assumptions with the previous answer, sorry. You
>>  need bioperl-live to get that to work, I don't think it is in
>>  the 1.02 distro. 
>>
>>  Additionally, I only tested with fasta files, I assume that
>>  anything else will still work, as long as the sequence has a
>>  description.  The query name is built up like
>>
>>	$header{'QUERY'} = ">".(defined $seq->display_id() ?
>>  $seq->display_id() : "").
>>		" ".(defined $seq->desc() ? $seq->desc() :
>>  "")."\n".$seq->seq();
>>
>>  so, the sequences have to have a display id and description
>>  to get a query name?
>>
>>
>>  My previous example was only slightly off, I left out the
>>  description.
>  >
>  > >U20499_EXON_1A 2848-2960 of U20499
>  > acactggaccttcaaaaccctcagggcagagagcagccctacactccctacaccacaccc
>>  atactcagcccctgcaggcaaggagagaacaggtcaggttcccgagagctcag
>>
>>  results in query name of
>>  U20499_EXON_1A 2848-2960 of U20499
>>
>>  parsed from the header of this blast result (saved from the
>>  remote blast)
>>
>>  BLASTN 2.2.4 [Aug-26-2002]
>>
>>
>>  Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro
>>  A. Schaffer,
>>  Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
>>  "Gapped BLAST and PSI-BLAST: a new generation of protein
>>  database search
>>  programs",  Nucleic Acids Res. 25:3389-3402.
>>  RID: 1033569396-029169-20578
>>  Query= U20499_EXON_1A 2848-2960 of U20499
>>           (113 letters)
>>
>>  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,
>>  or phase 0, 1 or 2 HTGS sequences)
>>             1,406,693 sequences; 6,799,009,920 total letters
>>
>>  Check the actual blast results, and make sure that has the
>  > query name in it, if it doesn't, then we have a problem...
>  >
>  > Here is the more current documentation
>  > http://doc.bioperl.org/bioperl-live/Bio/Tools/Run/RemoteBlast.html
>  >
>  > -Mat
>  >
>  >
>  > > -----Original Message-----
>>  > From: Lewis Lukens [mailto:llukens@uoguelph.ca]
>>  > Sent: Wednesday, November 20, 2002 2:49 PM
>>  > To: bioperl-l@bioperl.org
>>  > Subject: [Bioperl-l] recovering blast query_name
>>  >
>>  >
>>  > Hello,
>>  >
>>  > Sorry for a basic question... I have been trying to use the
>>  > Bio::Tools:Run:RemoteBlast module to blast a single file with many
>>  > fasta formated sequences against ncbi nt and parse the
>>  blast reports.
>>  > Almost everything is working well.  I get all the hit and hsp
>>  > features for all the hits.  I can recover the query sequence, but I
>  > > can't seem to recover the query sequence names.  How does
>  > one do this?
>  > >
>  > > I used almost the exact code as in the Remoteblast Synopsis
>>  > http://doc.bioperl.org/releases/bioperl-1.0.2/Bio/Tools/Run/Re
>>  > moteBlast.html
>>  >
>>  > in this code, this expression works:
>>  > print "db is ", $result->database_name(), "\n";
>>  >
>>  > but, these expressions return empty fields:
>  > >      my $name = $result->query_name();
>>  >      my $desc = $result->query_description();
>>  >      my $acc= $result->query_accession();
>>  >
>>  > I have been using SearchIO to parse blast output files and
>>  never had
>>  > this problem before.  Any ideas?
>>  >
>>  > Thanks much,
>>  > Lewis
>>  > --
>>  > Lewis Lukens
>>  > Assistant Professor
>>  > Department of Plant Agriculture
>>  > Univ. of Guelph, Guelph, Ontario. N1G 2W1
>>  >
>>  > Tel: (519) 824- 4120 ext 2304
>>  > _______________________________________________
>>  > Bioperl-l mailing list
>>  > Bioperl-l@bioperl.org
>>  > http://bioperl.org/mailman/listinfo/bioperl-l
>>  >
>>
>_______________________________________________
>Bioperl-l mailing list
>Bioperl-l@bioperl.org
>http://bioperl.org/mailman/listinfo/bioperl-l


-- 
Lewis Lukens
Assistant Professor
Department of Plant Agriculture
Univ. of Guelph, Guelph, Ontario. N1G 2W1

Tel: (519) 824- 4120 ext 2304