[Bioperl-l] alignment

[Jason Stajich]

You can't really use the pSW for this - we've covered this on the list
recently.  We'll try and move these nuggets of info out to the tutorial
and FAQ as time permits.

I'd suggest moving toward the emboss 'water' tool for smith-waterman
alignments rather than Ewan's pSW.

See my recent post:
http://bioperl.org/pipermail/bioperl-l/2002-February/007272.html



On Tue, 19 Feb 2002, Guoneng Zhong wrote:

> Hi,
> Has anyone done a simple pairwise alignment on DNA strands?  The
> examples in the docs and tutorial are about protein alignment using the
> Smith-Waterman algorithm.  I tried to assign a dna matrix to the
> "-matrix" parameter and it kept telling me that my sequences are not
> proteins.  Here is the code snippet:
>
> $seq1 = Bio::Seq->new
> (-id=>"seq1",-seq=>"AATTATATAATATATCTCTCCTCTTGCTCTC");
> $seq2 = Bio::Seq->new
> (-id=>"seq2",-seq=>"AATTATATAATATATGCCTCCCCCTTACTCTC");
> #$factory = new Bio::Tools::pSW('-matrix'=>'NUC4X4HB.MNT');
> $factory = new Bio::Tools::pSW('-matrix'=>'nu.bla');
> $aln = $factory->pairwise_alignment($seq1,$seq2);
> foreach $seq ($aln->eachSeq()){
>      print "$seq\n";
> }
>
> Any idea why?  Or does this module work only for proteins?
>
yep.
> Thanks,
> G
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@bioperl.org
> http://bioperl.org/mailman/listinfo/bioperl-l
>

-- 
Jason Stajich
Duke University
jason@cgt.mc.duke.edu