[Bioperl-l] New code

[Ewan Birney]

Chris - that would be great - this sort of "easy access" can work for a
whole series of users as you mention.


I have just commit'ed the start of Bio::Perl object - do you want to add
to it? 


We should not add the BLAST parsing stuff until Jason tells us the "one
blast parser to rule them all" 



I've attached the pod2text of Bio::Perl so far - newbies on the list
(Elizabeth? Others?) does this look good to you?



NAME
    Bio::Perl - Functional access to BioPerl for people who don't
    like objects

SYNOPSIS
       use Bio::Perl qw(read_sequence read_all_sequences write_sequence new_sequence get_sequence);

       # will guess file format from extension
       $seq_object = read_sequence($filename); 

       # forces genbank format
       $seq_object = read_sequence($filename,'genbank'); 

       # reads an array of sequences
       @seq_object_array = read_all_sequences($filename,'fasta'); 

       # sequences are Bio::Seq objects, so the following methods work
       # (for more info see Bio::Seq documentation - try perldoc Bio::Seq)

       print "Sequence name is ",$seq_object->display_id,"\n";
       print "Sequence acc  is ",$seq_object->accession_number,"\n";
       print "First 5 bases is ",$seq_object->subseq(1,5),"\n";

       # get the whole sequence as a single string

       $sequence_as_a_string = $seq_object->seq();

       # writing sequences

       write_sequence(">$filename",'genbank',$seq_object);

       write_sequence(">$filename",'genbank',@seq_object_array);
     
       # making a new sequence from just strings you have
       # from something else

       $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA","myname","AL12232");

       # getting a sequence from a database (assummes internet connection)

       $seq_object = get_sequence('swissprot',"ROA1_HUMAN");

       $seq_object = get_sequence('embl',"AI129902");

       $seq_object = get_sequence('genbank',"AI129902");   

DESCRIPTION
    Easy first time access to BioPerl via functions

FEEDBACK
  Mailing Lists

    User feedback is an integral part of the evolution of this and
    other Bioperl modules. Send your comments and suggestions
    preferably to one of the Bioperl mailing lists. Your
    participation is much appreciated.

      bioperl-l@bio.perl.org

  Reporting Bugs

    Report bugs to the Bioperl bug tracking system to help us keep
    track the bugs and their resolution. Bug reports can be
    submitted via email or the web:

      bioperl-bugs@bio.perl.org
      http://bio.perl.org/bioperl-bugs/

AUTHOR - Ewan Birney
    Email bioperl-l@bio.perl.org

    Describe contact details here

APPENDIX
    The rest of the documentation details each of the object
    methods. Internal methods are usually preceded with a _

  read_sequence

     Title   : read_sequence
     Usage   : $seq = read_sequence('sequences.fa')
               $seq = read_sequence($filename,'genbank');
       
               # pipes are fine
               $seq = read_sequence("my_fetching_program $id |",'fasta');

     Function: Reads the top sequence from the file. If no format is given, it will
               try to guess the format from the filename. If a format is given, it
               forces that format. The filename can be any valid perl open() string
               - in particular, you can put in pipes

     Returns : A Bio::Seq object - see perldoc Bio::Seq for more information
               (quick synopsis - 
                $seq_object->display_id - name of the sequence
                $seq_object->seq        - sequence as a string )

     Args    : Two strings, first the filename - any Perl open() string is ok
               Second string is the format, which is optional

  read_all_sequences

     Title   : read_all_sequences
     Usage   : @seq_object_array = read_all_sequences($filename);
               @seq_object_array = read_all_sequences($filename,'genbank');

     Function: Just as the function above, but reads all the sequences in the
               file and loads them into an array.

               For very large files, you will run out of memory. When this
               happens, you've got to use the SeqIO system directly (this is
               not so hard! Don't worry about it!). See perldoc Bio::SeqIO
               for more information

     Returns : array of Bio::Seq objects

     Args    : two strings, first the filename (any open() string is ok)
               second the format (which is optional)

  write_sequence

     Title   : write_sequence
     Usage   : write_sequence(">new_file.gb",'genbank',$seq)
               write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)

     Function: writes sequences in the specified format, 

     Returns : Nothing

     Args    : filename as a string, must provide an open() output file
               format as a string
               one or more sequence objects

  new_sequence

     Title   : new_sequence
     Usage   :
     Function:
     Example :
     Returns : 
     Args    :

  get_sequence

     Title   : get_sequence
     Usage   : $seq_object = get_sequence('swiss',"ROA1_HUMAN");

     Function: If the computer has internet accessibility, gets
               the sequence from internet accessible databases. Currently
               this supports Swissprot, EMBL and GenBank.

               Swissprot and EMBL are more robust than GenBank fetching

     Returns : A Bio::Seq object

     Args    : database type - one of swiss, embl or genbank
               identifier or accession number