[Biojava-dev] multiple alignment

[Spencer Bliven]

To make sure that this doesn't get forgotten, I created an issue for it on
github:

https://github.com/biojava/biojava/issues/288

On Wed, Jun 17, 2015 at 10:08 AM, Jose Manuel Duarte <jose.duarte at psi.ch>
wrote:

>  Hi Stefan
>
> Just a couple of comments, but not much direct help.
>
> From the source code I can see that the multiple alignment proceeds in 4
> steps: 1) pairwise alignments for all pairs, 2) hierarchical clustering
> into a guide tree, 3) progressive alignment and 4) refinement. However the
> refinement step doesn't seem to be implemented yet (there's a TODO in the
> code). That might explain the poorer result.
>
> Another thing to take into account is that there are a couple of known
> bugs in pairwise alignments at the moment:
>
> https://github.com/biojava/biojava/issues/274
>
> https://github.com/biojava/biojava/issues/213
>
> From those, #213 may have some relation to the problem you are seeing, but
> it's hard to tell.
>
> Jose
>
>
>
> On 17.06.2015 03:07, stefan harjes wrote:
>
>  Hi biojava,
>
>  I am fighting with the multiple alignment of several DNASequences. When
> I use the biojava computation I get alignments errors regarding the gaps.
> Clustalx computes a much better result in comparison:
>
>  biojava
>  TTGGGGCCTCTAAACGGGGTCTT
> TTGGGGC-TCTAAC--GGGTCTT
> TTGGGGCCTCTAAACGGG-TCTT
>
> clustal
> TTGGGGCCTCTAAACGGGGTCTT
> TTGGGG-CTCT-AACGGG-TCTT
> TTGGGGCCTCTAAACGGG-TCTT
> ****** **** ****
>  The most important difference is the second gap in the middle sequence,
> which is obviously better aligned in clustal. Any hints as to how to
> improve the biojava parameters/algorithms?
>
>  Cheers
> Stefan
> p.s.
>  I already tried to implement the actual gapPenalty which clustal uses
> which is 10/.1 for the pairwise and 10/.2 for the multiple alignment. (i.e.
> I changed all java short types to int, scaled all scoring parameters
> including the matrix by 10 and implemented two different gapPenalties in
> the two alignments). Unfortunately this does not change anything.
>  Does any of you guys have a copy of the IUB scoring matrix? which would
> be my next try?
>
>
>
>
> _______________________________________________
> biojava-dev mailing listbiojava-dev at mailman.open-bio.orghttp://mailman.open-bio.org/mailman/listinfo/biojava-dev
>
>
>
> _______________________________________________
> biojava-dev mailing list
> biojava-dev at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/biojava-dev
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.open-bio.org/pipermail/biojava-dev/attachments/20150625/23913b3a/attachment.html>