[MOBY-l] Presentation on the WWW site?

[Mark Wilkinson]

"Jason E. Stewart" wrote:

>  3) Namespace.
>
> Yeah ...
> I'd rather not, but I can't think of a better alternative.

Me neither.


> For now, I think it would be simplest with flat files and CVS. Since
> we're likely to make major changes left and right, it seems more
> flexible.

except that MOBY-Central (when I get around to starting on the code) will
have to query it...

perhaps a bit of both worlds is the solution, similar to how GO started?  A
flat file for day to day updating, and a database which is rebuilt on a
~regular basis.  Presuming that one day the flat files will disappear it
allows me to start coding the "end product" right away.


> Why not just use the top-level <MOBY> object for this purpose? The
> <ID> object would have no new attributes, so it seems redundant.

That wont work under the current structure.  <MOBY...> is more of an envelope
than an object.  Query objects (or more importantly in this discussion, LISTS
of query objects) are contained within it.  If you want to use the <MOBY>
envelope to hold the query itself, then you end up with the currently illegal
situation of having multiple <MOBY> tags in your SOAP payload.  I can't see
any way of getting around having a 'generic' ID object, which then has a CV
attribute of namespace to describe what kind of ID it is.

In a sense, this suggests that all other objects are overloaded in their base
form...  i.e.

    <Sequence    namespace="GenbankAcc"   id="A234742.2">
        <Seq> ACTAGCTAGCGTATCGATCGTA</Seq>
    </Sequence>

is actually read as "The Sequence object with the ID object of namespace
'GenbankAcc' and value 'A234742.2' has the sequence ACATGCATG..."   Would it
perhaps be more correct to write it this way:

    <Sequence>
        <ID   namespace="GenbankAcc"   id="A234743.3"/>
        <Seq> ACTAGCTGATCGTACTG</Seq>
    </Sequence>


Which representation do you think is more consistent?


> Yes, I believe we did.

that makes me happy!


> Let me know if you need help.

in more ways than I can count!!   ;-)

M



--
--------------------------------
"Speed is subsittute fo accurancy."
________________________________

Dr. Mark Wilkinson
Bioinformatics Group
National Research Council of Canada
Plant Biotechnology Institute
110 Gymnasium Place
Saskatoon, SK
Canada