[MOBY-guts] biomoby commit

[Eddie Kawas]

kawas
Tue Sep  1 16:13:20 EDT 2009
Update of /home/repository/moby/moby-live/Perl/MOBY-Server/t
In directory dev.open-bio.org:/tmp/cvs-serv17301/MOBY-Server/t

Modified Files:
	CommonSubs.t 
Log Message:
modified CommonSubs.t to reflect that one of the tests using an incorrect namespaceURI use to pass when it should have failed.
modified CommonSubs.pm: 
  now we compare the actual namespaceURI to http://www.biomoby.org/moby and dont extract content unless the elements and attributes properly resolve.
CommonSubs is now more strict w.r.t. biomoby services api
moby-live/Perl/MOBY-Server/t CommonSubs.t,1.1,1.2
===================================================================
RCS file: /home/repository/moby/moby-live/Perl/MOBY-Server/t/CommonSubs.t,v
retrieving revision 1.1
retrieving revision 1.2
diff -u -r1.1 -r1.2
--- /home/repository/moby/moby-live/Perl/MOBY-Server/t/CommonSubs.t	2008/02/21 00:21:28	1.1
+++ /home/repository/moby/moby-live/Perl/MOBY-Server/t/CommonSubs.t	2009/09/01 20:13:20	1.2
@@ -13,6 +13,10 @@
 #use SOAP::Lite +trace;
 use Test::More 'no_plan'; #skip_all => "Turned off for development"; #'no_plan';
 use strict;
+
+use FindBin qw ($Bin);
+use lib "$Bin/../lib/";
+
 use English;
 use Data::Dumper;
 #Is the client-code even installed?
@@ -138,7 +142,7 @@
 
 # Test getInputArticles with one, and with more  than one mobyData block.
 my $two_mobyDatas = <<INP_ART;
-<MOBY xmlns:moby="http://local/namespace">
+<MOBY xmlns:moby="http://www.biomoby.org/moby">
     <moby:mobyContent>
       <moby:mobyData queryID="first">
           <Simple>
@@ -161,6 +165,31 @@
 ok ($ids[0] eq "first") or die "serviceResponseParser didn't find the first query id\n";
 ok ($ids[1] eq "second") or die "serviceResponseParser didn't find the second query id that included a moby: namespace\n";
 
+# pass 2 invalid messages ... should not parse
+$two_mobyDatas = <<INP_ART;
+<MOBY xmlns:moby="http://www.local/namespace">
+    <moby:mobyContent>
+      <moby:mobyData queryID="first">
+          <Simple>
+            <Object namespace="blah" id="blah"/>
+          </Simple>
+      </moby:mobyData>
+      <moby:mobyData moby:queryID="second">
+          <Simple>
+            <Object namespace="blah" id="blah"/>
+          </Simple>
+      </moby:mobyData>
+    </moby:mobyContent>
+    </MOBY>
+INP_ART
+
+$responses = serviceResponseParser($two_mobyDatas); # returns MOBY objects
+print Dumper($responses);
+isa_ok ($responses, "HASH", "response parser returned a HASH" ) or die "serviceResponseParser didn't return a hashref for multiple input test\n";
+ at ids = keys %{$responses};
+ok (scalar(@ids) == 0) or die "serviceResponseParser didn't find right number of invocation messages when two invalid ones were passed\n";
+
+
 
 my $sequence = "TAGCTGATCGAGCTGATGCTGA";
 my $articlename = "SequenceString";