[MOBY-guts] biomoby commit

[Mark Wilkinson]

mwilkinson
Tue Jun 19 16:49:39 EDT 2007
Update of /home/repository/moby/moby-live/Perl/t
In directory dev.open-bio.org:/tmp/cvs-serv16493/t

Modified Files:
	CommonSubs.t 
Log Message:
adding a test for the moby: namespace into the commonsubs test harness
moby-live/Perl/t CommonSubs.t,1.7,1.8
===================================================================
RCS file: /home/repository/moby/moby-live/Perl/t/CommonSubs.t,v
retrieving revision 1.7
retrieving revision 1.8
diff -u -r1.7 -r1.8
--- /home/repository/moby/moby-live/Perl/t/CommonSubs.t	2007/02/09 00:19:01	1.7
+++ /home/repository/moby/moby-live/Perl/t/CommonSubs.t	2007/06/19 20:49:39	1.8
@@ -145,7 +145,7 @@
             <Object namespace="blah" id="blah"/>
           </Simple>
       </moby:mobyData>
-      <moby:mobyData queryID="second">
+      <moby:mobyData moby:queryID="second">
           <Simple>
             <Object namespace="blah" id="blah"/>
           </Simple>
@@ -159,7 +159,7 @@
 @ids = keys %{$responses};
 ok (scalar(@ids) == 2) or die "serviceResponseParser didn't find right number of invocation messages when two were passed\n";
 ok ($ids[0] eq "first") or die "serviceResponseParser didn't find the first query id\n";
-ok ($ids[1] eq "second") or die "serviceResponseParser didn't find the second query id\n";
+ok ($ids[1] eq "second") or die "serviceResponseParser didn't find the second query id that included a moby: namespace\n";
 
 
 my $sequence = "TAGCTGATCGAGCTGATGCTGA";