[EMBOSS] eprimer3 does not interface properly with primer3_core

[Peter Cock]

Hi Horea,

Which command are you using to try to run the EMBOSS primer3
wrapper? e.g. eprimer3 or eprimer32?

Sample data, based on your query over at Biopython:
https://github.com/biopython/biopython/issues/485

$ curl "http://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?rettype=fasta&tool=biopython&db=nucleotide&id=aj627603&retmode=text"
-o AJ627603.fasta
  % Total    % Received % Xferd  Average Speed   Time    Time     Time  Current
                                 Dload  Upload   Total   Spent    Left  Speed
100  7412    0  7412    0     0   7245      0 --:--:--  0:00:01 --:--:--  9050

Locally I get:

$ eprimer3 --version
EMBOSS:6.5.7.0
$ eprimer3 -auto -sequence AJ627603.fasta -out AJ627603.eprimer3
$ cat AJ627603.eprimer3

# EPRIMER3 RESULTS FOR AJ627603.1

#                      Start  Len   Tm     GC%   Sequence

   1 PRODUCT SIZE: 201
     FORWARD PRIMER    4896   20  59.97  55.00  GGAGTACTTCCAACCGGTCA

     REVERSE PRIMER    5077   20  59.98  55.00  CTGAGGCTTTGACCCAGAAG


   2 PRODUCT SIZE: 200
     FORWARD PRIMER    5783   20  60.12  50.00  GCACTGATTTCGACCAGGTT

     REVERSE PRIMER    5963   20  59.89  50.00  GCTAACCAGCGTTTTCGTTC


   3 PRODUCT SIZE: 195
     FORWARD PRIMER    4896   20  59.97  55.00  GGAGTACTTCCAACCGGTCA

     REVERSE PRIMER    5071   20  59.98  55.00  CTTTGACCCAGAAGCCAGAG


   4 PRODUCT SIZE: 201
     FORWARD PRIMER    4855   20  59.83  60.00  GACCTGGTAGGCTCAGATGC

     REVERSE PRIMER    5036   20  60.09  55.00  TTCTCTTGGTCCCAGTCCAC


   5 PRODUCT SIZE: 203
     FORWARD PRIMER    2750   20  59.98  50.00  AGACAATCGGCTGCTCTGAT

     REVERSE PRIMER    2933   20  59.84  55.00  CAATAGCAGCCAGTCCCTTC


(It looks like we have the old version of primer3 installed locally?)

$ eprimer32 --version
EMBOSS:6.5.7.0

$ eprimer32
Pick PCR primers and hybridization oligos
Died: eprimer32 uses external program 'primer32_core' which is not in
the PATH or defined as EMBOSS_PRIMER32_CORE
     Part of the 'primer3' package, version 2.2.3, available from the
     Whitehead Institute. See: http://primer3.sourceforge.net/ The
     primer3_core application must be renamed to primer32_core


Peter

On Sat, Mar 28, 2015 at 10:28 PM, Horea Christian <h.chr at mail.ru> wrote:
> I was able to reproduce this issue with primer3-2.3.6 as well.
>
>
> On Sa, 2015-03-28 at 22:42 +0100, Horea Christian wrote:
>
> As seen in this discussion [https://www.biostars.org/p/102268/] primer3
> (primer3_core) needs the SEQUENCE_TEMPLATE to be set in a config file.
> Apparently eprimer does not do this.
>
> This discussion
> [https://www.mail-archive.com/emboss@lists.open-bio.org/msg01980.html] is
> referenced in the above thread to support the claim that primer32 should be
> used instead, but it actually states that the proper function to use for
> primer3-2.3.* is primer3.
>
> My versions:
> emboss-6.6.0
> primer3-2.3.5
>
> Could you help me out?
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/emboss
>
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/emboss