[EMBOSS] Antwort: Pipe not working

Michael Muratet mmuratet at hudsonalpha.org
Mon Jan 9 15:14:10 UTC 2012


On Jan 9, 2012, at 12:58 AM, david.bauer at bayer.com wrote:

>
> Hi Mike,
>
> if you send a plain sequence via stdin to an EMBOSS program, you  
> must explicitly specify the sequence format as "plain".
>
> echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter -sformat plain
>
> David.
Thanks, David. That was the problem.
Mike
> emboss-bounces at lists.open-bio.org schrieb am 08/01/2012 17:57:35:
>
> > Greetings
> >
> > It seems like this should work:
> >
> > $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome  -filter
> > Error: Unable to read sequence 'stdin'
> > Died: palindrome terminated: Bad value for '-sequence' with -auto
> > defined
> >
> > and yet as you can see, it does not. I haven't used it for awhile,  
> but
> > I recall it used to work.
> >
> > I've searched the docs and tried all the permutations on the  
> command I
> > can think of and I'm getting nowhere.
> >
> > Does anyone see a problem with the command or have a suggestion  
> where
> > to search for a problem?
> >
> > Thanks
> >
> > Mike
> >
> > Michael Muratet, Ph.D.
> > Senior Scientist
> > HudsonAlpha Institute for Biotechnology
> > mmuratet at hudsonalpha.org
> > (256) 327-0473 (p)
> > (256) 327-0966 (f)
> >
> > Room 4005
> > 601 Genome Way
> > Huntsville, Alabama 35806
> >
> >
> >
> >
> >
> > _______________________________________________
> > EMBOSS mailing list
> > EMBOSS at lists.open-bio.org
> > http://lists.open-bio.org/mailman/listinfo/emboss

Michael Muratet, Ph.D.
Senior Scientist
HudsonAlpha Institute for Biotechnology
mmuratet at hudsonalpha.org
(256) 327-0473 (p)
(256) 327-0966 (f)

Room 4005
601 Genome Way
Huntsville, Alabama 35806








More information about the EMBOSS mailing list