[EMBOSS] Pipe not working

[Michael Muratet]

Greetings

It seems like this should work:

$ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome  -filter
Error: Unable to read sequence 'stdin'
Died: palindrome terminated: Bad value for '-sequence' with -auto  
defined

and yet as you can see, it does not. I haven't used it for awhile, but  
I recall it used to work.

I've searched the docs and tried all the permutations on the command I  
can think of and I'm getting nowhere.

Does anyone see a problem with the command or have a suggestion where  
to search for a problem?

Thanks

Mike

Michael Muratet, Ph.D.
Senior Scientist
HudsonAlpha Institute for Biotechnology
mmuratet at hudsonalpha.org
(256) 327-0473 (p)
(256) 327-0966 (f)

Room 4005
601 Genome Way
Huntsville, Alabama 35806