[EMBOSS] DNA sequence as input argument

[Steve Taylor]

Hi,

>
> Is there any way in which one can read a DNA sequence directly from the
> command line (that is
> as a string input argument) rather than from a file? I am especially
> interested in finding repeats,
> inverted repeats etc. (e.g. 'einverted', 'etandem' EMBOSS apps). Instead
> of creating a FASTA file
> for each query sequene, I would like to read the sequence directly from
> the command line. Is this possible?
>

 From http://emboss.sourceforge.net/docs/faq.html


A) The "filename" is really the sequence. This is a quick and easy way of reading in a short fragment of sequence without having to enter it into a file.

For example:

    % program -seq asis::ATGGTGAGGAGAGTTGTGATGAGA


Steve