[EMBOSS] EMBOSS seqret : IntelliGenetics and new DOS lines

[Peter Rice]

Peter C. wrote:
> However, if we now convert this input file to use DOS/Windows
> newlines, and repeat the test (on Mac OS X, so Unix):
> 
> $ embossversionReports the current EMBOSS version number
> 6.1.0
> $ seqret -sequence emboss_ig.txt -sformat ig -osformat fasta -auto -filter
>  H.sapiens fau mRNA, 518 bases
> ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtcgccaatatgc
>
> i.e. The ">" is missing on all the FASTA sequences.

Actually, it's not missing ... it is hiding.

The sequence id has a ^M appended to it, so the '> and the id get
overwritten by the description when you look at the file.

Fixed by processing the IG format ID rather than simply copying it.

Thanks for finding that one.

regards,

Peter Rice