[EMBOSS] Antwort: Indexing the ID field of EMBL-formatted databases.

[david.bauer at bayerhealthcare.com]

Hi Charles,

you should try the new indexing program dbxflat. 
I have miRNA.dat indexed with this and retrieval with ID and ACC work fine 
on my system (EMBOSS 4.1.0).

HTH,
David.


emboss-bounces at lists.open-bio.org schrieb am 29/05/2007 10:37:10:

> Dear list,
> 
> I have tried to index mirbase, the miRNA database, with dbiflat, but in 
that
> case I can only retrieve the seqences by their accession numbers, and 
not by
> their IDs:
> 
> gslc12『mirbase3』$ seqret mirbase:MI0004658 stdout
> Reads and writes (returns) sequences
> >mmu-mir-690 MI0004658 Mus musculus miR-690 stem-loop
> uguguuuuuguggagcuaauuggcuguauuaaagugcuaguaagaaacauucuccuccag
> cuggagagauggcucagcuguuaaaggcuaggcucacaaccaaaauaua
> 
> gslc12『mirbase3』$ seqret mirbase:mmu-mir-690 stdout
> Reads and writes (returns) sequences
> Error: Unable to read sequence 'mirbase:mmu-mir-690'
> Died: seqret terminated: Bad value for '-sequence' and no prompt
> 
> gslc12『mirbase3』$ seqret mirbase-ID:mmu-mir-690 stdout
> Reads and writes (returns) sequences
> Error: Unable to read sequence 'mirbase-ID:mmu-mir-690'
> Died: seqret terminated: Bad value for '-sequence' and no prompt
> 
> gslc12『mirbase3』$ seqret mirbase-id:mmu-mir-690 stdout
> Reads and writes (returns) sequences
> Error: Unable to read sequence 'mirbase-id:mmu-mir-690'
> Died: seqret terminated: Bad value for '-sequence' and no prompt
> 
> Here is the command line I used:
> 
>  dbiflat -dbname mirbase\
>                  -idformat EMBL\
>                 -directory .\
>                 -filenames miRNA.dat\
>                 -release 9.1\
>                 -date `date +%d/%m/%y`\
>                 -outfile /dev/stdout
> 
> And here is the embossrc I use:
> 
> DB mirbase [
>   type: N
>   format: embl
>   method: emblcd
>   directory: /usr/share/mirbase/emboss
>   file: *.dat
> ]
> 
> Is it a bug, or did I miss something ?
> 
> Have a nice day,
> 
> -- 
> Charles Plessy
> http://charles.plessy.org
> Wako, Saitama, Japan
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss