[EMBOSS] new format EMBL flat files index

[pmr at ebi.ac.uk]

Dear Olivier,

> I try to make indexes for the release 87 of EMBL with new first line
> format:
>
> * I downloaded EMBOSS-3.0.0
>
> * gunzip, tar xvf ...
>
> * I replaced the files with the files in the fixes directory

There was a new fix last week for the embl87 format. As you see the
"emblnew" format, I assume you are using the latest fix.

> but when I try the seqret application I obtained this output:
>
>  >.1; .1; Human cytomegalovirus strain AD169 complete genome
> gggccgcgtggtgggtcctcgaggggcgggggggtgtttttagcgggggggtgaaacttg
> gagttgcgtgtgtggacggcgactagttgcgtgtggtgcggaggacggcgacggcgaata
> aaagcgacgtgcggcgcgcacggcgaaaagaagacgcgtgtctgtgtctgtgtgattccc
> ...

That is what you see without the fixes. Can you check all the fix files
were copied, including ajax/ajseqread.c which seqret uses to read the new
format.

> I tried to index these new files with EMBLNEW format (in place of EMBL)
> as specified in the README file in the fixes directory but it is not a
> valid format.

emblnew is a sequence format, not an indexing format (dbiflat, dbxflat,
and anything reading embl files should read both formats with the new
fixes.

> Does anyone index the new format EMBL flat file successfully?

Yes, I did ... but if anyone else has problems please let me know.

I will try tomorrow to set up a simple test for everyone to check on a
short embl database.

regards,

Peter