[EMBOSS] showseq and overlapping ORFs

[Derek Gatherer]

Hello again

I wonder if showseq is bugged.  Look at the following:

[gath01d at gamma ebv]$ showseq hhv8.fa -format 0 -trans 100-200 -out test.showseq
Display a sequence with features, translation etc..
Specify your own things to display
          S : Sequence
          B : Blank line
          1 : Frame1 translation
          2 : Frame2 translation
          3 : Frame3 translation
         -1 : CompFrame1 translation
         -2 : CompFrame2 translation
         -3 : CompFrame3 translation
          T : Ticks line
          N : Number ticks line
          C : Complement sequence
          F : Features
          R : Restriction enzyme cut sites in forward sense
         -R : Restriction enzyme cut sites in reverse sense
          A : Annotation
Enter a list of things to display [B,N,T,S,A,F]: b,s,1

Choosing b,s,1 here gives:


AF148805.2
Human herpesvirus 8 isolate GK18, complete genome

           TACTAATTTTGAAAGGCGGGGTTCTGCCAGGCATAGTCTTTTTTTGTGGCGGCCCTTGTG


           TAAACCTGTCTTTCAGACCTTGTTGGACATCCCGTACAATCAAGATGTTCCTGTATGTTG
                                                  S  R  C  S  C  M  L

           TTTGCAGTCTGGCGGTTTGCTTTCGAGGACTATTAAGCCTTTCTCTGCAATCGTCTCCAA
           F  A  V  W  R  F  A  F  E  D  Y  *  A  F  L  C  N  R  L  Q

           ATCTCTGCCCTGGAGTGATTTCAACGCCTTACACGTTGACCTGTCCGTCTAATACATCCT
           I  S  A  L  E  *  X

           TGCCAACATCCTGGTATTGCAACGATACTCGGCTTTTACGAGTGACGCAGGGAACATTGA


ie. a nice frame 1 translation in the frame requested.

but if I choose b,s,-1, I get:

AF148805.2
Human herpesvirus 8 isolate GK18, complete genome

           TACTAATTTTGAAAGGCGGGGTTCTGCCAGGCATAGTCTTTTTTTGTGGCGGCCCTTGTG
             V  L  K  S  L  R  P  E  A  L  C  L  R  K  K  H  R  G  K  H

           TAAACCTGTCTTTCAGACCTTGTTGGACATCCCGTACAATCAAGATGTTCCTGTATGTTG
             L  G  T  K  *  V  K  N  S  M  G  Y  L  *  S  T  G  T  H  Q

           TTTGCAGTCTGGCGGTTTGCTTTCGAGGACTATTAAGCCTTTCTCTGCAATCGTCTCCAA
             K  C  D  P  P  K  S  E  L  V  I  L  G  K  E  A  I  T  E  L

           ATCTCTGCCCTGGAGTGATTTCAACGCCTTACACGTTGACCTGTCCGTCTAATACATCCT
             D  R  G  Q  L  S  K  L  A  K  C  T  S  R  D  T  *  Y  M  R

           TGCCAACATCCTGGTATTGCAACGATACTCGGCTTTTACGAGTGACGCAGGGAACATTGA
             A  L  M  R  T  N  C  R  Y  E  A  K  V  L  S  A  P  F  M  S

ie the frame -1 translation over the whole thing.

So is -trans only really supposed to work with frame 1?? or is this a 
bug?  I notice that transeq has in its "known bugs":

"When using the '-regions' option, you should always leave the 
'-frames' option at the default of frame '1'."

Has this been carried over into showseq?


Cheers
Derek