[EMBOSS] can't access databases indexed by dbifasta

[Marcus Claesson]

I entered a 'field' in both dbifasta and emboss.defaults and it works
now! This is what I did (I have one last tiny question in the end):

[blast_db]$ dbifasta -fields des
Index a fasta database
    simple : >ID
     idacc : >ID ACC
     gcgid : >db:ID
  gcgidacc : >db:ID ACC
      dbid : >db ID
      ncbi : | formats
ID line format [idacc]: ncbi
Database directory [.]: 
Wildcard database filename [*.dat]: ecoli.nt
Database name: ecoli_nt
Release number [0.0]: 
Index date [00/00/00]:

in emboss/emboss.defaults:
DB ecoli_nt [
   type: N
   format: fasta
   method: emblcd
   dir: 
   indexdir: 
   file: ecoli.nt
   fields: des
]

[blast_db]$ showdb
Displays information on the currently available databases
# Name        Type ID  Qry All Comment
# ====        ==== ==  === === =======
ecoli_nt      N    OK  OK  OK  -


Now this works:
[marcus]$ seqret ecoli_nt:NC_0012\*
>NC_001224.1 NC_001224.1 Saccharomyces cerevisiae mitochondrion,
complete genome
TTCATAATTAATTTTTTATATATATATTATATTATAATATTAATTTATATTATAAAAATA
ATATTTATTATTAAAATATTTATTCTCCTTTCGGGGTTCCGGCTCCCGTGGCCGGGCCCC
GGAATTATTAATTAATAATAAATTATTATTAATAATTATTTATTATTTTAT


But this doesn't work and I don't know why since I added the 'des
field'. Are queries like these suppose to work by the way?

[marcus]$ seqret ecoli_nt:\*mitochondrio\* -auto -stdout
Error: Unable to read sequence 'ecoli_nt:*mitochondrio*'
Died: seqret terminated: Bad value for '-sequence' with -auto defined


Thanks for all help so far!

Marcus






On Tue, 2004-02-17 at 16:48, Jérôme Laroche wrote:
> Marcus,
> 
> which one is the right? Because in the first, at the question "Wildcard 
> database filename:" you enter only ecoli and I think that your sequence 
> file is ecoli.nt It is only at the line "Database name:" that you enter 
> the name ecoli (without the nt). If it doesn't work, check again your 
> emboss_default file and ensure you have the requested field for your 
> database and your index and the right syntax for the location of your 
> file.
> 
> Finally, reply to all, for all the people know what is the right thing 
> to do in that case.
> 
> 
> Good luck!
> 
> Jerome
> 
> 
> > This is how I created it:
> > [blast_db]$ dbifasta
> > Index a fasta database
> >     simple : >ID
> >      idacc : >ID ACC
> >      gcgid : >db:ID
> >   gcgidacc : >db:ID ACC
> >       dbid : >db ID
> >       ncbi : | formats
> > ID line format [idacc]:
> > Database directory [.]: /var/data/blast_db
> > Wildcard database filename [*.dat]: ecoli
> > Database name: ecoli
> >
> 
> > [marcus at neo blast_db]$ dbifasta
> > Index a fasta database
> >     simple : >ID
> >      idacc : >ID ACC
> >      gcgid : >db:ID
> >   gcgidacc : >db:ID ACC
> >       dbid : >db ID
> >       ncbi : | formats
> > ID line format [idacc]:
> > Database directory [.]: /var/data/blast_db
> > Wildcard database filename [*.dat]: ecoli.nt
> > Database name: ecoli
> > Release number [0.0]:
> > Index date [00/00/00]:
> 
> 
> 
> Jerome
> 
> Centre de bioinformatique
> Pavillon Charles-Eugène-Marchand
> Bureau 4233d
> tél: 418-656-2131 poste 6184
> fax: 418-656-7176
> www.bioinfo.ulaval.ca
> Le 04-02-17, à 11:29, Marcus Claesson a écrit :
> 
> > Thanks Jerome it works! However there is one thing I don't understand
> > (or I just misunderstood the syntax)...
> >
> > This happens when I want a certain entry from this new ecoli db:
> >
> > [marcus]$ seqret ecoli:AE00011\* -stdout -auto
> > Error: Unable to read sequence 'ecoli:AE00011*'
> > Died: seqret terminated: Bad value for '-sequence' with -auto defined
> >
> > The entry looks like:
> > [marcus]$ seqret ecoli -stdout -auto |head
> >> AE000111 AE000111.1 Escherichia coli K-12 MG1655 section 1 of 400 of
> > the complete geno
> > me
> > AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTC
> > TGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTT
> >
> >
> > This is how I created it:
> > [blast_db]$ dbifasta
> > Index a fasta database
> >     simple : >ID
> >      idacc : >ID ACC
> >      gcgid : >db:ID
> >   gcgidacc : >db:ID ACC
> >       dbid : >db ID
> >       ncbi : | formats
> > ID line format [idacc]:
> > Database directory [.]: /var/data/blast_db
> > Wildcard database filename [*.dat]: ecoli
> > Database name: ecoli
> > [marcus at neo blast_db]$ dbifasta
> > Index a fasta database
> >     simple : >ID
> >      idacc : >ID ACC
> >      gcgid : >db:ID
> >   gcgidacc : >db:ID ACC
> >       dbid : >db ID
> >       ncbi : | formats
> > ID line format [idacc]:
> > Database directory [.]: /var/data/blast_db
> > Wildcard database filename [*.dat]: ecoli.nt
> > Database name: ecoli
> > Release number [0.0]:
> > Index date [00/00/00]:
> >
> >
> > Thanks again!
> > Marcus
> >
> >
> > On Tue, 2004-02-17 at 15:50, Jérôme Laroche wrote:
> >> Marcus,
> >>
> >> as suggested earlier by David, take a different name for your 
> >> database.
> >> Take only ecoli or something else. I try this with my data and I got
> >> the same problem.
> >>
> >>
> >> Jerome
> >>
> >> Centre de bioinformatique
> >> Pavillon Charles-Eugène-Marchand
> >> Bureau 4233d
> >> tél: 418-656-2131 poste 6184
> >> fax: 418-656-7176
> >> www.bioinfo.ulaval.ca
> >> Le 04-02-17, à 10:41, Marcus Claesson a écrit :
> >>
> >>>
> >>>> 'seqret ecoli.nt:\*' perhaps?
> >>>
> >>> Nope, same bad result...
> >>>
> >>> /M
> >>>
> >>
> >
>