[EMBOSS] Question about DeltaS and DeltaH

[Bassi, Sebastian]

Hello Guy Bottu,

Thank you very much! Now I traced the problem back to the code, and the problem was that the function I used (string.count) counts "non-overlapping" ocurrences. I will search for a replace of this function or maybe I will have to write my own.
Thank you again!

UPDATE: Thank to another member of the BioPython list, I finish this. He did the string count with overlapping support and I did the rest.

Sebastian Bassi.
Advanta Seeds. Balcarce Research Station.
 

> -----Original Message-----
> From: Guy Bottu [mailto:gbottu at ben.vub.ac.be]
> Sent: Thursday, November 27, 2003 8:37 AM
> To: Bassi, Sebastian
> Subject: Re: [EMBOSS] Question about DeltaS and DeltaH
> 
> 
> from : Belgian EMBnet Node
> 
> 	Dear Sebastian,
> 
> The reason is simply that you forgot a CC pair.
> 
> Don't worry, it happens to all of us. I will never forget the 
> day when I 
> sent a bug report to Prof. Felsenstein, complaining that the PHYLIP 
> package did not run properly on my computer, while I had used a wrong 
> input file format...
> 
> 	Regards,
> 	Guy Bottu
> 
> > 
> > Take this sequence: ACCCTTCAGCAGTTCCACAC
> > 
> > Here are all neighbors and their DeltaS values:
> > 
> > AC = 22.4
> > CC = 19.9
>   CC = 19.9
> > CT = 21
> > TT = 22.2
> > TC = 22.2
> > CA = 22.7
> > AG = 21
> > GC = 24.4
> > CA = 22.7
> > AG = 21
> > GT = 22.4
> > TT = 22.2
> > TC = 22.2
> > CC = 19.9
> > CA = 22.7
> > AC = 22.4
> > CA = 22.7
> > AC = 22.4
> > Grant total = 396.4
>                 416.3
>